... Its taxo- nomic reasoning facilitates semantic type-class reasoning during grammatical analysis. INTRODUCTION The Inheritance Grammar (IG) formalism is an extension of Hassan Ait-Kaci's ... eSrd ACL Conference, Chicago, IL. Pereira, F.C.N. and Warren, D.H.D. 1980. Definite Clause Grammars for Language Analysis - A Survey of the Formalism and a Comparison with Augme...
Ngày tải lên: 31/03/2014, 17:20
... Natl Acad Sci USA 102, 4235–4239. 33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase ... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx
... relationship between the random DA and the random DR. Denote the random DA by X and the random DR by Y . Given a text corpus, let n ij be the accumulated count that R i occurs in a sentence labeled ... infor- mation data set harvested from the databases avail- able on the web, e.g., Wikipedia and Google Map. A- data consists of 1, 603 sentences with 317 word types. The second type...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. ... each row. The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted un...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... temperature until all free water was evaporated. After this, IR spectra were recorded at room temperature and at 37 °C. Usually, the original spectra were evaluated directly and a spectral analysis ... triggers inflammatory response in rat astrocytes. Brain Res. 803, 34–38. 10. Matsuda, K., Harasawa, R., Li, J L., Kasama, T., Taki, T., Handa, S. & Yamamoto, N. (1995) Identification of...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... L, Hamid Q & Elias JA (2004) Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 304, 1678– 1682. 4 Kasprzewska A (2003) Plant chitinases ) regulation ... domains that are at least as large as those of the plant enzymes and that may contain at least six subsites [26,30]. However, the catalytic domains of ChiG, ChiC and most other known bac...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... HepG 2 cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaIsiteandBack 6I ... kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland. Almost no expression was observed...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA Bacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL Bicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV 130 ... gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig. S3). Surface area per molecule was calculated by a assum...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
... a heavy chain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signaling tail. Like MHC class I HC, the FcRn counterpart is noncovalently associated ... vicinal cysteines 251 and 252. The ion at m ⁄ z 2332.06 (Fig. 4C) was selected for fragmentation, and observed y-, b- and a- fragment ions are indicated. For an easier illust...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAc- oAB (Table 2) imply that the COOH group has to be posi- tioned as in NIPAB for ... The distances between the polar CO 2 – and O(NO) and positively charged guanidinium fragments of ArgA145 and ArgB263 are listed in Table 3. AM1 docking calculations show uniform...
Ngày tải lên: 16/03/2014, 16:20