Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

... V max parameters was used as the base model for parameter scanning using routines contained in GEPASI . METHODS Model A model of branched glycolysis, as described in [7] was obtained in SCAMP format ... glycolytic pathway. Much effort has already been invested in mathematical modelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosom...

Ngày tải lên: 17/03/2014, 11:20

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... interactions [21]. If a smaller set of amino acids is structurally and functionally viable, then complete sampling becomes feasible for libraries in which a larger number of am...

Ngày tải lên: 19/02/2014, 12:20

... GCCATGCTAGCAATCATCACCGTAG CHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423 MIH-LF GAGTTATCAACGACGAGTGTCC MIH-LR GAGACGACAAGGCTCAGTCC 249 AK-LF AAAGGTTTCCTCCACCCTGT AK-LR ACTTCCTCGAGCTTGTCACG 450 CHH-SF GACTTGGAGCACGTGTGT CHH-SR ... premoult. Materials and methods Animals and peptides Carcinus maenas were collected using baited traps in the Menai Strait, UK, and maintained in a recirculating seawate...

Ngày tải lên: 21/02/2014, 00:20

... MINIREVIEW Adipocyte hyperplasia and RMI1 in the treatment of obesity Akira Suwa, Takeshi Kurama and Teruhiko Shimokawa Drug Discovery Research, Astellas Pharma Inc., Ibaraki, Japan Introduction Obesity ... Matsumoto, and Masanori Naitou at Astellas Pharma Inc., and Mses Chihiro Yamazaki and Rie Fujikawa at Trans Genic Inc. for their helpful advice and support. References 1 Hausman DB, Di...

Ngày tải lên: 06/03/2014, 01:20

... counter (LKB, Wallac, Finland). All animals were maintained and handled according to local and national ethical guidelines. Animal model of septic shock Two groups, each containing 40 female NMRI mice ... IL-1b). All animals were maintained and handled according to local and national ethical guidelines. Statistical analysis Data are represented as means ± SD. The significance of the resu...

Ngày tải lên: 07/03/2014, 01:20

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 ... TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA Ub Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTG...

Ngày tải lên: 07/03/2014, 03:20

... is much faster. This way of looking at our results may make it appear that parsing was a waste of time and effort, of value only as a lesson in how not to go about dictionary analysis. Before ... the tagging program is the lexical analyzer, and the head finder is a syntax analyzer using a very simple finite state grammar of about ten rules. Despite its lack of li...

Ngày tải lên: 08/03/2014, 18:20

... problem clinically, and 40% of patients who relapse on imatinib therapy have point mutations in the BCR–ABL kinase domain, including the T315I gatekeeper mutation that impairs imatinib binding [58,59]. ... prosurvival extracellular signal- regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2) and protein kinase B (PKB) pathways that act downstream of oncogenic protein kinases [10,11]. It is increasingly ap...

Ngày tải lên: 16/03/2014, 00:20

... Mn-SOD, catalase and glutathione reductase were from Sigma (Deisenhofen, Germany). Preparation and incubation of brain mitochondria This work was conducted in accordance with the regula- tions of the ... glutamate, 5 mm malate, and 200 lm ADP were added to the incubation to induce state 3 respiration and oxygen consumption was analysed. The corresponding values are shown in Fig. 1. Af...

Ngày tải lên: 16/03/2014, 22:20

... CREB, CRE-binding protein; EIA, enzyme immunoassay; ERK, extracellular signal-regulated kinase; MEK, mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase kinase; pAb, polyclonal antibody; ... increases the intracellular calcium level and activates various kinases including MEK [16,18–20]. MEK, also known as MAPK kinase [34], is an activator of ERK, a MAPK. The MEK ⁄ ER...

Ngày tải lên: 28/03/2014, 22:20