Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

... loop residues adapts to each binding ligand in its own way and swings out only as much as is mandatory. Results and Discussion Crystals of the complex of stefin A and cathepsin B contain complete ... red). Table 1. Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases. Distance calculated d (A ˚ ) Papain–stefin B 23.93 Cathepsin H–stefin...

Ngày tải lên: 18/02/2014, 04:20

... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of ... 7.0) at a concentration of 0.5 mgÆmL )1 . Spec- tra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 nmÆmin )...

Ngày tải lên: 20/02/2014, 01:20

... CAF-1 – a molecular link between recombination and chromatin assembly during meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and ... 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT. CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG. To over- express N-termina...

Ngày tải lên: 07/03/2014, 05:20

... the final NER F1 results. We compare to the state -of- the-art methods of Ando and Zhang (2005), Suzuki and Isozaki (2008), and for NER—Lin and Wu (2009). Tables 2 and 3 show that accuracy can be ... reduce data sparsity in the labeled training data, semi-supervised approaches improve generalization accuracy. Semi-supervised models such as Ando and Zhang (2005), Suzuki and Isoza...

Ngày tải lên: 20/02/2014, 04:20

... utter- ances (about 72% of the annotated SSR data) can be given a semantic analysis in the following sec- tions. For each well-formed and grammatical sen- tence, all (non-auxiliary and non-modal) ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 746–754, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP What lies beneath: Se...

Ngày tải lên: 20/02/2014, 07:20

... Thus, associated with the derivation of (2c) are the assertions that the situation associated with B is a cause for that associated with A and that the situ- ation associated with B is one of a ... work to date surely shows the benefit of an approach that narrows the gap between dis- course syntax and semantics and that of the clause. References Nicholas Asher and...

Ngày tải lên: 20/02/2014, 18:20

... the range of syntactic pos- sibilities and the parser will align tone group and move syntactic boundaries at a later stage. By integrating syntax and semantics, the Parser is capable of resolving ... terms of available system functions. A dia- logue manager manages interaction with the speaker and retrieves database information, 3. PROSODY EXTRACTION As the input to...

Ngày tải lên: 20/02/2014, 21:20

... Onoduka J, Homma K, Yamaguchi S, Mori M, Higashi Y, Makita M, Kinoshita T, Noda J, Itabe H et al. (2006) Long-chain fatty acids induce lipid droplet formation in a cultured human hepatocyte in a manner ... 3,17-androstanediol and abundant expression in steroidogenic tissues such as placenta and gonads have been described [7]. 17b-HSD11 also has a protein domain of glucose ⁄ ribi...

Ngày tải lên: 07/03/2014, 05:20

... membrane and periplasmic space, whereas PilM, PilN and PilO are inner membrane proteins that probably form part of the assembly platform and are involved in the assembly of the DNA translocator complex ... membrane, whereas PilW, PilQ and PilA4 are located in the inner and outer membranes. These data show that PilMNOWQ and PilA4 are components of a DNA translocator struc...

Ngày tải lên: 07/03/2014, 12:20

... Huey-Jen Fang 1 and Tian-Yow Tsong 2,3 1 Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan 2 Institute of Physics, Academia Sinica, Taipei, Taiwan 3 Department of Biochemistry, ... K110 and K133. Other charged amino acids such as D73, D83 and E101 reinforce the interactions of E75 and E129. H M. Chen et al. Local stability and key acidic amino acids in s...

Ngày tải lên: 07/03/2014, 21:20