Báo cáo Y học: Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold potx
Báo cáo Y học: Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold potx
... ribosome associated factor Y (Eur. J. Biochem. 269) 5191 Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold Keqiong Ye 1 , Alexander Serganov 1 , ... genomes, and in Arabidopsis thaliana and Spinacia oleracea plant sequences. A search using FASTA [34] and BLAST [35] revealed only a few hits with significant iden...
Ngày tải lên: 17/03/2014, 10:20
Tài liệu Báo cáo khoa học: Tissue factor pathway inhibitor is highly susceptible to chymase-mediated proteolysis pptx
... tryptase. Biochemistry 40, 7342–7349. 18 Nakahara Y, Miyata T, Hamuro T, Funatsu A, Miyagi M, Tsunasawa S & Kato H (1996) Amino acid sequence and carbohydrate structure of a recom- binant ... H, Ishihara M, Yonemura H, Miyamoto S, Funatsu A, Enjyoji K, Abumiya T, Miyata T & Kato H (1994) Amino acid sequence and inhibitory activity of rhesus monkey tissue factor pathway inhibi...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Platelet factor 4 disrupts the intracellular signalling cascade induced by vascular endothelial growth factor by both KDR dependent and independent mechanisms ppt
... lgÆmL )1 ). Raf1 activity was quantified after Raf1 immunop recipitation, by means of an in vitro kinase assay. Raf1 specific activity i s expressed as relative activity (C). Values a re m eans ± SD ... CXCR3B (forward) 5¢-TGCCAGGCCTTTACAC AGC-3¢; (reverse) 5¢-TCGGCGTCATTTAGCACTTG-3¢. GAPDH (forward) 5¢-CCACCCATGGCAAATTCCAT GGCA-3¢; (reverse) 5¢-TCTAGACGGCAGGTCAGG TCCACC-3¢. Flow cytometry Ce...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... a multigene family is regulated by transcription factor TFIIIB Akhila Parthasarthy and Karumathil P. Gopinathan Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, ... derivative of tRNA Gly 1 -1 has a single TATA ele- ment at )130 bp and is transcribed to the same levels as the parent. pmutRKX3 has the single TATATAA element of pRKX3 mutated to GATATCA....
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... 17] a s a template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). ... 5B, lane 10). Similarly, steady state analysis did not A B Fig. 4. In vivo analysis of S ufI export in Dtig, DdnaKdnaJ and Dtig DdnaKdnaJ mu tants. S teady state (A) and pulse-chase...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Nuclear factor TDP-43 can affect selected microRNA levels pptx
... possibility that warrants experimental testing in the future. let-7b RNA Pol II miR-663 RNA Pol II miR-574-5p RNA Pol II miR-558 RNA Pol II m7G AAAAA m7G AAAAA m7G AAAAA m7G AAAAA pri-let-7b pri-miR-663 pri-miR-574-5p pri-miR-558 pre-miRNA miRNA TDP -43 Gene(s) ... antibody (Abcam, Cambridge, MA, USA). Microarray and direct miRNA analysis Total RNA from TDP-43 siRNA, control siRNA-t...
Ngày tải lên: 22/03/2014, 21:21
Báo cáo khoa học: Complement factor 5a receptor chimeras reveal the importance of lipid-facing residues in transport competence doc
... USA 2 Laboratory for Molecular Cardiology, Danish National Research Foundation Centre for Cardiac Arrhythmia, The Heart Centre, Copenhagen University Hospital, Denmark 3 Laboratory for Molecular ... display a lower binding affinity similar to the BFA-treated wild-type receptor and, based on our localization data, fail to reach the plasma membrane. This internal receptor population is prope...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot
... this work and were maintained at the Laboratory Ani- mal Centre of the National Yang Ming University, Taipei. This study was approved by the Institutional Animal Care and Use Committee (IACUC) of ... statistical analysis of the luciferase assay data; values of P < 0.05 were considered significant. Preparation of nuclear extracts and total protein lysates Nuclear extracts and protein lysates...
Ngày tải lên: 29/03/2014, 00:20
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot
... triplicate. GALNS enzyme activity GALNS activity was assayed with 4-methylumbeliferyl-b-d- galactopyranoside-6-sulfate (Toronto Chemicals Research, North York, Canada) as a substrate. The enzyme assay was ... [2]. Keywords adeno-associated virus-derived vector; cytomegalovirus immediate early enhancer ⁄ promoter; mucopolysaccharidosis IVA; N-acetylgalatosamine-6-sulfate sulfatase; sulfatase...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot
... TGTGGCTCTGTGGAACATTT Sp1FP GGACTACCTGGAGTGATGCCTAA Sp1RP CCCATCAACGGTCTGGAACT AP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCR AP- 2a RP CAGGTCGGTGAACTCTTTGCA b-actinFP GCGCGGCTACAGCTTCA b-actinRP CTTAATGTCACGCACGATTTCC Fig. ... ChIP Sp1 ⁄ chipF GGACTACCTGGAGTGATGCCTAA ChIP Sp1 ⁄ chipR CCCATCAACGGTCTGGAACT ChIP AP- 2a ⁄ si GCUCCACCUCGAAGUACAATT RNAi Sp1 ⁄ si NNAGCGCUUCAUGAGGAGUGA RNAi KCTD10FP...
Ngày tải lên: 30/03/2014, 02:20