Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

... experimental data with the aid of a computer. As a result, the pH-dependence curves for the autoxidation rate of the separated a and b chains have been analysed completely in terms of an Ôacid-catalysed ... the rate constants k A 0 and k B 0 .In fact, the catalytic proton enhances the rate dramatically both in the separated a and b chains, by a factor of more than 10 6 p...

Ngày tải lên: 17/03/2014, 10:20

11 371 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma. ... H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hams...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Tài liệu Báo cáo khoa học: "A New Dataset and Method for Automatically Grading ESOL Texts" pdf

Tài liệu Báo cáo khoa học: "A New Dataset and Method for Automatically Grading ESOL Texts" pdf

... extract an error-rate in a way that doesn’t require manually tagged data. However, we also use an error-rate calculated from the CLC error tags to ob- tain an upper bound for the performance of an ... training data as a separate classifier is trained for each grade point. Recently, Chen et al. (2010) has proposed an un- supervised approach to AA of texts addressing the same topic,...

Ngày tải lên: 20/02/2014, 04:20

10 538 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

... PCR was performed on an egfp-containing plasmid (a gift from Dr K. Apt, Martek Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense ... (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI r...

Ngày tải lên: 07/03/2014, 21:20

11 668 0
Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx

Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx

... anti- sense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; anti- sense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG TCTC-3¢) ... 5¢-CAATACTGTCT TTCTGGCCTTC-3¢, and that of s-DNA is 5¢-ATAGGCG GGAATTTTGCATC-3¢. Anti-TMV siRNA was synthe- sized using the DNA templates 5¢-AAGGGACGAGCA TATGTACACCCTGTCTC-3¢ and 5¢-A...

Ngày tải lên: 16/03/2014, 02:20

9 449 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢ ;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-C...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... creates a reasonable alignment of the labelled data from which multigram counts can be obtained. The labelled data is a small list of transliteration pairs. Therefore we use the unlabelled data ... and to use probabili- ties from unlabelled data where the labelled data is sparse. This is achieved by smoothing the labelled data probabilities using the unlabelled data probabil- ities as...

Ngày tải lên: 19/02/2014, 19:20

9 521 0
Tài liệu Báo cáo khoa học: "A Gibbs Sampler for Phrasal Synchronous Grammar Induction" docx

Tài liệu Báo cáo khoa học: "A Gibbs Sampler for Phrasal Synchronous Grammar Induction" docx

... insert/delete sampler. A pair of adjacent nodes in a ternary rule can be re-parented as a binary rule, or vice-versa. falls between two existing terminals whose tar- get phrases are adjacent, then any new ... expressive grammars would be a straightforward extension of our model. 3 Related work Most machine translation systems adopt the approach of Koehn et al. (2003) for ‘...

Ngày tải lên: 20/02/2014, 07:20

9 474 1
Tài liệu Báo cáo khoa học: "A Modular Toolkit for Coreference Resolution" pdf

Tài liệu Báo cáo khoa học: "A Modular Toolkit for Coreference Resolution" pdf

... which uses a classical combination of tagger and chun- ker, with the Stanford POS tagger (Toutanova et al., 2003), the YamCha chunker (Kudoh and Mat- sumoto, 2000) and the Stanford Named Entity ... use of the coreference resolution as part of a larger sys- tem, but also performing qualitative error analysis using integrated MMAX2 functionality (annotation 1 An open source version o...

Ngày tải lên: 20/02/2014, 09:20

4 419 0
Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt

Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt

... accuracy (RA) and leaf accuracy (LA), as in (Yamada and Matsumoto, 2003). When evaluating the result, we exclude the punctuation marks, as done in (Mc- Donald et al., 2005) and (Yamada and Matsumoto, 2003). 4.3 ... evaluation data sets were provided by the tagger of (Toutanova et al., 2003) (which has an accuracy of 97.2% section 70 23 of the Penn Treebank). 4.1 Features for Action Cl...

Ngày tải lên: 20/02/2014, 12:20

8 581 0
w