Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

... experimental data with the aid of a computer. As a result, the pH-dependence curves for the autoxidation rate of the separated a and b chains have been analysed completely in terms of an Ôacid-catalysed ... the rate constants k A 0 and k B 0 .In fact, the catalytic proton enhances the rate dramatically both in the separated a and b chains, by a factor of more than 10 6 p...

Ngày tải lên: 17/03/2014, 10:20

... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma. ... H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hams...

Ngày tải lên: 07/03/2014, 09:20

... extract an error-rate in a way that doesn’t require manually tagged data. However, we also use an error-rate calculated from the CLC error tags to ob- tain an upper bound for the performance of an ... training data as a separate classifier is trained for each grade point. Recently, Chen et al. (2010) has proposed an un- supervised approach to AA of texts addressing the same topic,...

Ngày tải lên: 20/02/2014, 04:20

... PCR was performed on an egfp-containing plasmid (a gift from Dr K. Apt, Martek Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense ... (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI r...

Ngày tải lên: 07/03/2014, 21:20

... anti- sense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; anti- sense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG TCTC-3¢) ... 5¢-CAATACTGTCT TTCTGGCCTTC-3¢, and that of s-DNA is 5¢-ATAGGCG GGAATTTTGCATC-3¢. Anti-TMV siRNA was synthe- sized using the DNA templates 5¢-AAGGGACGAGCA TATGTACACCCTGTCTC-3¢ and 5¢-A...

Ngày tải lên: 16/03/2014, 02:20

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢ ;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-C...

Ngày tải lên: 18/02/2014, 13:20

... creates a reasonable alignment of the labelled data from which multigram counts can be obtained. The labelled data is a small list of transliteration pairs. Therefore we use the unlabelled data ... and to use probabili- ties from unlabelled data where the labelled data is sparse. This is achieved by smoothing the labelled data probabilities using the unlabelled data probabil- ities as...

Ngày tải lên: 19/02/2014, 19:20

... insert/delete sampler. A pair of adjacent nodes in a ternary rule can be re-parented as a binary rule, or vice-versa. falls between two existing terminals whose tar- get phrases are adjacent, then any new ... expressive grammars would be a straightforward extension of our model. 3 Related work Most machine translation systems adopt the approach of Koehn et al. (2003) for ‘...

Ngày tải lên: 20/02/2014, 07:20

... which uses a classical combination of tagger and chun- ker, with the Stanford POS tagger (Toutanova et al., 2003), the YamCha chunker (Kudoh and Mat- sumoto, 2000) and the Stanford Named Entity ... use of the coreference resolution as part of a larger sys- tem, but also performing qualitative error analysis using integrated MMAX2 functionality (annotation 1 An open source version o...

Ngày tải lên: 20/02/2014, 09:20

... accuracy (RA) and leaf accuracy (LA), as in (Yamada and Matsumoto, 2003). When evaluating the result, we exclude the punctuation marks, as done in (Mc- Donald et al., 2005) and (Yamada and Matsumoto, 2003). 4.3 ... evaluation data sets were provided by the tagger of (Toutanova et al., 2003) (which has an accuracy of 97.2% section 70 23 of the Penn Treebank). 4.1 Features for Action Cl...

Ngày tải lên: 20/02/2014, 12:20