Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx

Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx

Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx

... diacylglycerols of sea urchin. Trans- plantation 74, 261–267. 3 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk- age A, Yoshida S & Sakaguchi K (1998) ... alga, Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684– 686. 5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw- ara F, Matsukage A, Yoshida S & Sakaguchi K (1999) Action of a...

Ngày tải lên: 19/02/2014, 17:20

9 891 0
Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx

Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx

... Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family Morihiko Nakamura 1 and Yoshinori Tanigawa 2 1 Cooperative Medical Research ... contain an aliquot from the anti-PU1 a nity chromatography purification step; lanes 2 and 4 contain an aliquot from the hydroxylapatite purification step; lanes 1 and 2, s...

Ngày tải lên: 17/03/2014, 10:20

7 272 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento ... arachidonic acid chains, and at 0.93–2.04 p.p.m., attributed to linolenic acid chains on the basis of a comparison with lipid extracts and from the data available in the literature,...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate amplification of the target amplicon was checked by obtaining ... sequencing chemistry. Real-time quantitative PCR Quantitative RT-PCR analysis was performed using the iCycler apparatus (Bio-Rad, Hercules, CA, USA). Total RNA...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39–46. 34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y & Kishi ... the molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients with AMI and to validate the use of serum DNase I...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... plasma membrane receptor and the activation of the plasma membrane H + -ATPase. IV. Fusicoccin induces the association between the plasma membrane H + -ATPase and the fusicocci...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... obtain the full length sequence: OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢; OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG- 3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACG TG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCG...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH ... min, the absorbance of the supernatant was read at 363 nm. The absorbance of the reduced form of APAD (APADH) was linear over the 2–100 l M range of glutamate with a molar...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, Hirata M, Mazda O, Katsura Y & Narumiya S (1993) Thromboxane A2 receptor is highly expressed in mouse immature thymocytes and mediates DNA fragmentation and apoptosis. ... Grazia U, Felli MP, Vacca A, Farina AR, Maroder M, Cappabianca L, Meco D, Farina M, Screpanti I, Frati L et al. (1994) Positive and negative regulation of the com- posite octamer motif...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... asso- ciated with the plasma membrane of epidermal cells. At this magnification, the vacuolar membrane and the plasma membrane could not be resolved, because the vacuole takes a large part of the ... Hrazdina G & Jensen RA (1992) Spatial organization of enzymes in plant metabolic pathways. Annu Rev Plant Physiol Plant Mol Biol 43, 241–267. 4 Fujiwara H, Tanaka Y, Yonekura...

Ngày tải lên: 20/02/2014, 01:20

15 589 0
Từ khóa:
w