Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

... Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode Yann Astier 1 *, Suki Balendra 2 , H. Allen O. Hill 1 , Thomas ... electrochemical oxygenation; regulatory protein; soluble methane monooxygenase. Soluble methane monooxygenase (sMMO) catalyses the bacterial oxidation o...

Ngày tải lên: 17/03/2014, 09:20

6 464 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt

Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt

... proceeds with similar activity at both individual sites; cleavage rates are virtually identical, ligation rate constants vary by a factor of only about 2.5. Alteration of RNA sequence by the twin ribozyme HP–TWRJ The ... Secondary structures of ribozyme substrate complexes used for measuring cleavage (A) or ligation (B) rates at either site. Cleavage and ligation at the...

Ngày tải lên: 20/02/2014, 01:20

11 481 0
Báo cáo khoa học: "Parsing with Treebank Grammars: Empirical Bounds, Theoretical Models, and the Structure of the Penn Treebank" ppt

Báo cáo khoa học: "Parsing with Treebank Grammars: Empirical Bounds, Theoretical Models, and the Structure of the Penn Treebank" ppt

... signature , let be the number of ac- tive states in the grammar which have that signature. Now, take a state of signature and a span . If we align the tags in with words in and align the categories ... was relatively close to its bound , active saturation is much farther below . Furthermore, while passive saturation was relatively constant in span size, at least after a po...

Ngày tải lên: 17/03/2014, 07:20

8 405 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... reverse primers: CCAT CCATGGCTAGGAAGCAAGGGACAGC TCTCC, GGAT CCATGGTCATGGAAACATATCCATA AATCGG and CCAT CCATGGTCAGTTGATAGGAGC TGTGAAGAAAAC, respectively (all incorporating NcoI site, underlined). The resulting ... PCR amplification of the appropriate hSuv3p cDNA fragments using the following forward primer CCT GAATTCGATGCCAGCCTTATTCG AGATCTCC (EcoRI site underlined) and the reverse pri...

Ngày tải lên: 23/03/2014, 15:21

12 468 0
Báo cáo khoa học: Affinity purification-mass spectrometry Powerful tools for the characterization of protein complexes ppt

Báo cáo khoa học: Affinity purification-mass spectrometry Powerful tools for the characterization of protein complexes ppt

... molecules. These collisions result in cleavage of the peptide along the peptide backbone and creates a set of fragments that differ in length by one amino acid each. The masses of the fragments can again ... sequencing by Edman degradation. To date, hundreds to several thousands of proteins may be Fig. 1. Schematic representation of the tandem a nity purification met...

Ngày tải lên: 31/03/2014, 07:20

9 416 0
Báo cáo khoa học: Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy pot

Báo cáo khoa học: Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy pot

... titration of the irradiated DNA showed that about 50% of the bases had been converted to dimers (data not shown). Samples containing a mixture of photodamaged DNA and blue radical enzyme at an approximate ... (data not shown)] which appears as a valid model for the study of the DNA photorepair process. Photoactivation of the catalytically blue radical form of DNA p...

Ngày tải lên: 16/03/2014, 18:20

12 394 0
Báo cáo khoa học: "Predicting User Reactions to System Error" ppt

Báo cáo khoa học: "Predicting User Reactions to System Error" ppt

... ’ indicatesthat the featurevalue ofthe first cat- egory is either significantly higher or lower than the second. Note that, for each of the pairs, there is at least one prosodic feature that distinguishes the ... classification. Of the features that appear in the ruleset, about half are features of current turn and half features of the prior context. Only once does a sy...

Ngày tải lên: 17/03/2014, 07:20

8 215 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy Mogridge Department of Laboratory ... inducing vascular leakage that leads to shock and multiorgan failure [3–6]. The role of LeTx in anthrax pathogenesis is complex, however, and probably involves the impairment of the inna...

Ngày tải lên: 16/02/2014, 09:20

9 579 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

... aggregate at high concen- trations, etc. In the case of the T domain, the MG state corresponds to the functional state, which initi- ates the translocation of the catalytic domain. Here, the data allowed ... either acid -catalyzed or base -catalyzed [20]. As a consequence, the dependence of Log(k exch ) (the logarithm of the exchange rate) as a function of...

Ngày tải lên: 16/02/2014, 09:20

10 531 0
Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf

Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf

... Gelatinase-mediated migration and invasion of cancer cells. Biochim Biophys Acta 1755, 37–69. 4 Chen JM, Fortunato M, Stevens RA & Barrett AJ (2001) Activation of progelatinase A by mammalian legumain, ... Further, autoactivation of the active 62 kDa form to a C-terminally truncated 45 kDa form was also inhibited by TIMP-1. Investigation of mechanisms that may explain t...

Ngày tải lên: 18/02/2014, 11:20

12 572 0
w