Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt

... COLING/ACL 2006 Student Research Workshop, pages 25–30, Sydney, July 2006. c 2006 Association for Computational Linguistics Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech ... empirical sentence process- ing data. We use two modes of evaluation: one that relies on comparison with a con- trol sentence, paralleling practice in hu- man studies;...

Ngày tải lên: 17/03/2014, 04:20

... exons generating stable RNA products. Nature 379, 464–466. 36 Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J & Tuschl T (2003) The small RNA profile ... RNAs. Science 294, 853–858. 15 Griffiths-Jones S, Bateman A, Marshall M, Khanna A & Eddy SR (2003) Rfam: an RNA family database. Nucleic Acids Res 31, 439–441. 16 Kim J, Krichevsky A, Gr...

Ngày tải lên: 07/03/2014, 16:20

... results across dif- ferent data conditions. 1 Introduction State-of-the-art Statistical Machine Translation (SMT) requires a certain amount of bilingual cor- pora as training data in order to achieve ... segmentation can achieve state-of-the-art performance. Moreover, our approach can easily be scaled up to larger data sets and achieves com- petitive results if the small data used...

Ngày tải lên: 22/02/2014, 02:20

Ngày tải lên: 17/03/2014, 02:20

... developed such as rule-based analyzers and corpus-based analyzers that use machine-learning techniques. However, the maximum accuracy achieved by state-of-the art analyzers is almost 90% for news- paper articles; ... human to annotate. Under this framework, the system has access to a large pool of unlabeled data, and it has to predict how much it can learn from each candi- date in the po...

Ngày tải lên: 17/03/2014, 04:20

... categories and feature information and there is at least one leaf node labeled with a lexical category (such lexi- cal leaf nodes are known as anchors). For example, the canonical tree for a ditransitive ... the same way that the covariation of, say, syntactic and mor- phological form is treated. In particular, we can use the mechanisms that DATR already provides for fea- ture c...

Ngày tải lên: 17/03/2014, 09:20

... molecular mechanism for the Arg-tRNA synthetase-catalyzed deacylation of Arg- tRNA (Arg-tRNA + AMP fi Arg-AMP + tRNA at high pH), in which the deacylation of aminoacyl-tRNA bound on Arg-tRNA synthetase ... nucleotides (AGCCA 1 7a GGAC 2 0a A), respectively. The P. horikoshii tRNA Arg CCU gene (5¢-GGACCGGTAG CCTAGCCA 1 7a GGAC 2 0a AGGG CGGCGGCCTCCTAAG CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG CCA...

Ngày tải lên: 18/02/2014, 11:20

... Stephanou A, Wagstaff MJ, Coffin RS, Mar- ber MS, Engelmann G & Latchman DS (1999) Heat shock protein delivered with a virus vector can protect cardiac cells against apoptosis as well as against ... incubated with rabbit anti-ionized calcium-binding adapter molecule 1 (iba-1) (1 : 500; Wako, Osaka, Japan) and subsequently exposed to biotinylated goat anti-rabbit IgG and streptavidin...

Ngày tải lên: 18/02/2014, 17:20

... translation using semantic features. The two models are integrated into a state-of-the- art phrase-based machine translation system and evaluated on Chinese-to-English transla- tion tasks with ... only verbal predicates are semantically important, they also form a major part of the sentences. Therefore, whether verbal predicates are trans- lated correctly or not has a great impact on...

Ngày tải lên: 19/02/2014, 19:20

... (Ozkan et al., 2010): lexical, prosodic, part-of-speech, syntactic, and visual. Random Classifier Our last baseline model is a ran- dom backchannel generator as desribed by Ward and Tsukahara (2000). ... an absolute gold standard. Snow et. al. (2008) show that using non-expert la- bels for training machine learning algorithms can be as effective as using a gold standard annotation. In this...

Ngày tải lên: 20/02/2014, 05:20