Báo cáo khoa học: "Analysis of Selective Strategies to Build a Dependency-Analyzed Corpus" pptx

Báo cáo khoa học: "Analysis of Selective Strategies to Build a Dependency-Analyzed Corpus" pptx

Báo cáo khoa học: "Analysis of Selective Strategies to Build a Dependency-Analyzed Corpus" pptx

... has access to a large pool of unlabeled data, and it has to predict how much it can learn from each candi- date in the pool if that candidate is labeled. Most of the experiments that had been carried out ... Kyoto Text Cor- pus into ChaSen’s POS system because we used ChaSen, a Japanese morphological analyzer, and CaboCha 3 (Kudo and Matsumoto, 2002), a depen- dency analyzer inc...

Ngày tải lên: 17/03/2014, 04:20

8 488 0
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

... capture of the electron into an amide carbonyl group that is hydrogen bonded to the protonated side chain of a basic amino acid. The resulting radical anion abstracts a proton and gen- erates a radical ... inter- faced to a mass spectrometer equipped for ESI; (c) fragmentation of individual peptides by collision-acti- vated dissociation (CAD); and (d) a search of the res...

Ngày tải lên: 18/02/2014, 16:20

8 579 0
Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

... primers 5¢-GGAGATCTAAAATGGACGACTGGGAGGAAGA-3¢ and 5¢-GCGAATTCGTTGAAAACTTTTAATTATCA GGAGAAAAC-3¢,5¢-CGAGATCTAGCATGTCAGACG TGGAGTCTGGA-3¢ and 5¢-GCGAATTCGCAACCAAA GACAACCTGGTTTTAATGTTTTGA-3¢, and 5¢-CGAG ATCTGAAATGAACGAGCTGCGTATGCCGAA-3¢ ... 5¢-GCGCTAGCTAAT ACGACTCACT ATAG GGA GATC TAAA ATGG AC GAC TGGGAGGAAGA-3¢ and 5¢-GCGAATTCGTTGAAA ACTTTTAATTATCAGGAGAAAAC-3¢. This PCR frag- ment has a T7...

Ngày tải lên: 18/02/2014, 16:20

9 655 0
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

... University of Southampton, UK 3 Department of Anatomy and Neurobiology, Dalhousie University, Halifax, Canada Neuronal selective loss and formation of intraneuron- al protein aggregates are characteristics ... treatment with an antioxidant Wance J. J. Firdaus 1 , Andreas Wyttenbach 2 , Chantal Diaz-Latoud 1 , R. W. Currie 1,3 and Andre ´ -Patrick Arrigo 1 1 Laboratoire Stress Oxydant,...

Ngày tải lên: 19/02/2014, 06:20

18 721 0
Tài liệu Báo cáo khoa học: "ANALYSIS OF OONOUNCTIONS IN PAKSER" potx

Tài liệu Báo cáo khoa học: "ANALYSIS OF OONOUNCTIONS IN PAKSER" potx

... syn- tactic component of the FIDO system (a Flexible Interface for Database Operations), an interface allowing an end-user to access a relational data- base in natural language (Italian). INTRODUCTION ... ANALYSIS OF OONOUNCTIONS IN A ~JLE-~ PAKSER leonardo L~smo and Pietro Torasso Dipartimento di Informatica - Universita' di Torino Via Valperga Caluso 37 - 10125 Torin...

Ngày tải lên: 21/02/2014, 20:20

8 518 0
Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... Experimental procedures DNA A 74-mer ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New ... K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci USA 98, 5538–5543. 20 Kag...

Ngày tải lên: 06/03/2014, 09:22

13 447 0
Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

... Fairfax, VA, USA) with a CH-250 16-bit, cooled CCD camera (Photometrics, Tucson, AZ, USA). RNA extraction and northern blotting For analysis of levels of U4, U6 and U4 ⁄ U6 RNA, total RNA was ... 4% formaldehyde or methanol). Intensities of nuclear and cytoplasmic signals were measured using IMAGEJ 1.38w and the average ratios of nuclear ⁄ cytoplasmic signals are indicated within ea...

Ngày tải lên: 07/03/2014, 02:20

16 515 0
Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot

Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot

... and retinol dehydrogenase 2 are microsomal proteins that catalyze the reduc- tion of all-trans-retinaldehyde using NADH as cofactor, a remarkable com- bination of substrate and cofactor preferences. ... NLS-b-galactosidase protein, and with the pb-galactosidase-N2 empty vector (R). The pb-galac- tosidase-N2 vector contains a nuclear localization sequence (NLS) 5¢ to the LacZ gene. T...

Ngày tải lên: 07/03/2014, 09:20

14 478 0
Báo cáo khoa học: "Analysis of Unknown Words through Morphological Decomposition" potx

Báo cáo khoa học: "Analysis of Unknown Words through Morphological Decomposition" potx

... pronuncia- tion, and any characteristic suffix that may be present will allow for the assignment of a more accurate word class or classes (eg. +ness de- notes a noun, +ly an adverb). Morphological ... pronunciation of the known material would be derived from the lexicon). The advantages of this method are that the pronunciation and word stress assignment are more likely to...

Ngày tải lên: 09/03/2014, 01:20

6 413 0
Báo cáo khoa học: Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1 pot

Báo cáo khoa học: Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1 pot

... chemiluminescence; eIF, eukaryotic initiation factor; GAP, GTPase activator protein; GST, glutathione S-transferase; HIF 1a, hypoxia-inducible factor 1a; mTOR, mammalian target of rapamycin; mTORC1, mTOR complex ... Takahashi R, Yoshino KI, Tanimura K, Nakashima A, Eguchi S, Miyamoto T, Hara K, Takehana K, Avruch J et al. (2007) The proline-rich Akt substrate of 40 kDa (PRAS40) is a ph...

Ngày tải lên: 16/03/2014, 06:20

15 338 0
w