Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt

... generalize speaker’s intention into a pair of a speech act and a concept sequence. In the remains of this paper, we call a pair of a speech act and a concept sequence) an intention. 2.2 Intention ... predefined in- tentions at each dialogue step. 3 Evaluation 3.1 Data sets and experimental settings We collected a Korean dialogue corpus simulated in a...

Ngày tải lên: 17/03/2014, 02:20

... classi- fier, using character 1- through 6-grams (including word boundaries) as features. Since we could not manually annotate a large portion of the MZEE cor- pus, the training data consisted of ... Dissemination, Diversity, and Dynamics of English Borrowings in a German Hip Hop Forum Matt Garley Department of Linguistics University of Illinois 707 S Mathews Avenue Urbana,...

Ngày tải lên: 19/02/2014, 19:20

... set of negative in- stances is formed by pairing the anaphor and each of the intervening candidates. Based on the train- ing instances, a binary classifier is generated using a certain learning algorithm, ... (2002). In such a learning model, each training or testing instance takes the form of i{C, ana}, where ana is the possible anaphor and C is its antecedent candi- date. A...

Ngày tải lên: 20/02/2014, 15:20

... Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart cytochrome c oxidase at ... at 2.8 A. Science 269, 1069–1074. 14 Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono Characterization of respiratory complex II X. Huo...

Ngày tải lên: 19/02/2014, 02:20

... Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in ... of a novel base-pairing interaction in group I introns. Genes Dev 4, 777–788. 46 Ikawa Y, Shiraishi H & Inoue T (2000) Minimal cataly- tic domain of a group I self-splicing intr...

Ngày tải lên: 19/02/2014, 07:20

... TGGAAAGCTTGCCACATCAGTCTACAAAG 85R TGCTCCATGGTGGCATCCCAATATGTAAACCA 83 83F GAACCAAGCTTGAAGCACATTCTTGCAGTAAGCA 83R CAAAACATGTTGGCTACGGGACATACAAATGTTCA 80 80F GTTGAAGCTTTTTGAAACTTAGCACTTCTGC 80R ATTCCATGGTGGCTGAAATCATTTCATTTTGATTGCC 74 ... (5¢-CATACAA ACATAATAAGATGTAAATGG-3¢) and control g177c (5¢-TCATCTAAGTACAATAGATAGAAGAAA-3¢), g230 (5¢-TGTTACTCTCCAAGCAAC CA-3¢) and control g230c (5¢-GACACTTGT...

Ngày tải lên: 19/02/2014, 16:20

... decarboxylase inhibitor a- difluoromethyl- ornithine (DFMO) leads to massive intracellular build-up of AdoMet and a potential state of hypermethylation, causing cellular death in the parasite [14]. The information ... substitution of any of the cysteine residues in positions 35–105 in recombinant rat liver MAT causes changes in the MAT oligomeric status. Several authors have...

Ngày tải lên: 08/03/2014, 08:20

... by training identical statistical translation models for both translation di- rections using the same training data. We in- vestigate information retrieval between En- glish and French, incorporating ... translation become equivalent only if each word in one language is translated into a unique word in the other languages. In fact machine translation tends to be a many-to-...

Ngày tải lên: 17/03/2014, 07:20

... and complementary parameters were considered, as detailed in Table 1. A test of systematically removing one parameter at a time resulted in impaired prediction accuracy in all cases. As a preprocessing ... less often correlated with severe mutations. Other intuitively important factors are the similar amino acid variable and size change variable, as large changes in property...

Ngày tải lên: 18/02/2014, 11:20

... surrounding words of the input are regarded as the window. The mapping features are defined as the pairs of the output phrase and 1-, 2-, and 3-grams in the window. The link features are important ... source domain, and the real-error sentences are from the target domain. Experiments show that sta- ble improvement is achieved by using domain adaptation. 1 Introduction Case marks o...

Ngày tải lên: 19/02/2014, 19:20