Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt

... generalize speaker’s intention into a pair of a speech act and a concept sequence. In the remains of this paper, we call a pair of a speech act and a concept sequence) an intention. 2.2 Intention ... predefined in- tentions at each dialogue step. 3 Evaluation 3.1 Data sets and experimental settings We collected a Korean dialogue corpus simulated in a schedule management domain such as ap-pointment ... lin-guistic features such as clue words, previous inten-tions, and a current state of a domain frame. 2 Statistical prediction of speakers’ inten-tions 2.1 Generalization of speakers’ intentions...

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... classi-ﬁer, using character 1- through 6-grams (includingword boundaries) as features. Since we could notmanually annotate a large portion of the MZEE cor-pus, the training data consisted of ... Dissemination, Diversity, and Dynamics of English Borrowings in a German Hip Hop ForumMatt GarleyDepartment of LinguisticsUniversity of Illinois707 S Mathews AvenueUrbana, IL 61801, USAmgarley2@illinois.eduJulia ... halves are classiﬁed separately, andif the maximum anglicism classiﬁer score out of allsplits exceeds a target conﬁdence c (=0.7), the orig-inal word is labeled a candidate anglicism. Parame-ter...

Tài liệu Báo cáo khoa học: "Improving Pronoun Resolution Using Statistics-Based Semantic Compatibility Information" doc

... set of negative in- stances is formed by pairing the anaphor and each of the intervening candidates. Based on the train-ing instances, a binary classiﬁer is generated using a certain learning algorithm, ... (2002). In such a learning model, each training or testinginstance takes the form of i{C, ana}, where ana isthe possible anaphor and C is its antecedent candi-date. An instance is associated ... itsclosest antecedent, Cante. A set of “10” instances,i{Cante, C, ana}, is generated by pairing Canteandeach of the interning candidates C. Also a set of “01”instances, i{C, Cante, ana},...

Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

... Tsukihara T, Aoyama H, Yamashita E, Tomizaki T,Yamaguchi H, Shinzawa-Itoh K, Nakashima R, YaonoR & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart cytochrome c oxidase at ... at 2.8 A. Science 269, 1069–1074.14 Tsukihara T, Aoyama H, Yamashita E, Tomizaki T,Yamaguchi H, Shinzawa-Itoh K, Nakashima R, YaonoCharacterization of respiratory complex II X. Huo et al.1528 ... 5¢-ATGGCTGCGCTGTTGCTGAGACACGTTG-3¢; R-CybL, 5¢-TCACATGGCTGCCAGCCCCATAGAGGAC-3¢; F-CybS, 5¢-ATGGCGGTTCTCTGGAGGCTGAGTGCCG-3¢; R-CybS, 5¢-CAGAGCTTCCACAGCATGGCAACAGCT-3¢.Fresh porcine heart from the slaughterhouse...

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTCACTATAGGGATCGAATTCTGGGTTCAAAACGTAA)contains, in ... of a novel base-pairing interaction in group I introns.Genes Dev 4, 777–788.46 Ikawa Y, Shiraishi H & Inoue T (2000) Minimal cataly-tic domain of a group I self-splicing intron RNA.Nature ... Withdivalent and monovalent salts as the only aids to RNAfolding, however, the formation of alternative, nonpro-ductive base pairs can trap a fraction of a large ribo-zyme in inactive conformations...

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

... TGGAAAGCTTGCCACATCAGTCTACAAAG85R TGCTCCATGGTGGCATCCCAATATGTAAACCA83 83F GAACCAAGCTTGAAGCACATTCTTGCAGTAAGCA83R CAAAACATGTTGGCTACGGGACATACAAATGTTCA80 80F GTTGAAGCTTTTTGAAACTTAGCACTTCTGC80R ATTCCATGGTGGCTGAAATCATTTCATTTTGATTGCC74 ... (5¢-CATACAAACATAATAAGATGTAAATGG-3¢) and control g177c(5¢-TCATCTAAGTACAATAGATAGAAGAAA-3¢),g230 (5¢-TGTTACTCTCCAAGCAAC CA-3¢) and controlg230c (5¢-GACACTTGTCATCACACTCA-3 ¢). For a na-lysis of ... containing iPLA2c sequence:P1, 5¢-TCAAGGTACCATGATTTCCTGAAGG-3¢;P2,5¢-CTGAAGATCTAGCCTTTACTTTCA-3¢;P3,5¢-GCTAGGTACCAATACAGTAATATATG-3¢;P4,5¢-TGCTAGATCTCCACCCACTCA-3¢;P5,5¢-TTATGGTACCTGAAAGGGAATAGCGGC-3¢;P6,5¢-GGCTGGTACCCTTGCGCTCCGTC-3¢;P7,5¢-GGAGAGATCTGCGGGAAGCCGCGACAGA-3¢;p8,5¢-TTCCAGAT...

Báo cáo khoa học: Leishmania donovani methionine adenosyltransferase Role of cysteine residues in the recombinant enzyme pptx

... decarboxylase inhibitor a- diﬂuoromethyl-ornithine (DFMO) leads to massive intracellular build-up of AdoMet and a potential state of hypermethylation, causingcellular death in the parasite [14]. The information ... substitution of any of the cysteineresidues in positions 35–105 in recombinant rat liver MATcauses changes in the MAT oligomeric status.Several authors have sustained that AdoMet is relevant in trypanosomatids ... tripolyphosphataseactivity of L. donovani recombinant MAT-II was meas-ured under the standard assay conditions described in ‘Material and methods’. Tripolyphosphatase activity waslinear over time and...

Báo cáo khoa học: "Should we Translate the Documents or the Queries in Cross-language Information Retrieval?" ppt

... by training identical statistical translation models for both translation di- rections using the same training data. We in- vestigate information retrieval between En- glish and French, incorporating ... translation become equivalent only if each word in one language is translated into a unique word in the other languages. In fact machine translation tends to be a many-to- one mapping in ... that finer shades of meaner are distinguishable in the original text than in the translated text. This effect is readily observed, for example, by machine translating the translated text back...

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... andcomplementary parameters were considered, as detailed in Table 1. A test of systematically removing one parameterat a time resulted in impaired prediction accuracy in allcases. As a preprocessing ... less often correlated withsevere mutations. Other intuitively important factorsare the similar amino acid variable and size changevariable, as large changes in property and size of anamino acid ... increasing the safety margin, we can gofrom 77% accuracy and an MCC value of 0.52 to88% accuracy and an MCC value of 0.74. The draw-back is that, in the latter case, only 45% of themutants are...

Tài liệu Báo cáo khoa học: "Grammar Error Correction Using Pseudo-Error Sentences and Domain Adaptation" pdf

... surrounding words of the inputare regarded as the window. The mapping features are deﬁned as the pairs of the output phrase and 1-,2-, and 3-grams in the window.The link features are important ... sourcedomain, and the real-error sentences are fromthe target domain. Experiments show that sta-ble improvement is achieved by using domainadaptation.1 IntroductionCase marks of a sentence are ... constructed by ac-quiring particle errors, and the CRF models aretrained using the alignment results as superviseddata.2.2 Insertion / DeletionSince an insertion can be regarded as replacing anempty...

Xem thêm