Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx

Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf

Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf

... Natl Cancer Inst 100, 109–120. 77 Minakuchi Y, Takeshita F, Kosaka N, Sasaki H, Yamamoto Y, Kouno M, Honma K, Nagahara S, Hanai K, Sano A et al. (2004) Atelocollagen-mediated synthetic small interfering ... that RNA aptamers can be facilely obtained by in vitro transcription reaction and, therefore, avoid contamination by cell or bacterial products. Promising in vitro and in vivo...

Ngày tải lên: 06/03/2014, 01:23

14 599 0
Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

... addition of a few grains of disodium dithionite. The Soret and a- band absorbance maxima are at 415 and 550 nm, respectively, for wild-type cytochrome c 550 , and at around 419 and 555 nm for the AXXAH-containing ... and CcmB are not involved in heme transport in E. coli [44,45]. Notably, maturation of an AXXAH-containing variant b -type cytochrome c 550 in the presen...

Ngày tải lên: 06/03/2014, 09:22

12 469 0
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

... overlap affecting the corresponding signals. Correlations were calculated by means of MATHEMATICA 5.2 software, using the relaxation dataset given in supplementary Table S2. Relaxation data obtained ... Universita ` di Udine, Italy Homeodomains (HDs) comprise a very well-known class of DNA-binding domains occurring in a large family of transcription activators involved in the...

Ngày tải lên: 18/02/2014, 16:20

14 744 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins, namely cono...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

... analysis of elafin and trappin-2 fractionated on heparin-Sepharose. The heparin-binding capacities of elafin and trappin-2 were evaluated by affinity chromatography using heparin- Sepharose. Elafin ... pneumoniae, Branhamella catarrhalis and the pathogenic fungi A. fumigatus and C. albicans. Our results indicate that trappin-2 has a broad antibacte- rial activity and is fungicida...

Ngày tải lên: 18/02/2014, 17:20

13 610 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... shortest functional domain from a crenarchaeal plasmid endowed with DNA and RNA synthesis and terminal transferase activity. Abbreviations AEP, archaeo-eukaryotic replicative primases; dNTP, deoxyribonucleotide; ... replicative primases (AEPs) [11]. Primase–polymerases (prim–pols) are a novel family of AEPs which are sporadically found in both bacterio- phages and crenarchaeal...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan ... kit (Stratagene, La Jolla, CA, USA). Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATC GCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGT GCT ATTCTACCAAAAGAATGG...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... sequencing. According to the sequencing result, a pair of PCR primers (sense: 5¢-GCGCATCCATATGAAATTAAAATCGTTTGG-3¢ and antisense: 5¢-CCGCTCGAGAAAAACGCTTCGCATGAC- 3¢) were synthesized to clone aroE gene ... performed at 4 °C. Protein concentration was determined by Bradford assay using bovine serum albumin as standard. Enzymatic activity assay The enzymatic activity of HpSDH was assaye...

Ngày tải lên: 19/02/2014, 05:20

11 529 0
Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

... phosphatase 2A interacts with the 70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein. Proc Natl Acad Sci USA 96, 4438–4442. 11 Petritsch C, Beug H, Balmain A & ... stimulated for various times, fixed and stained with an antibody against the C-terminus of S6K1. Using an fluoroscein isothiocyanate (FITC)-labeled secondary anti-rabbit IgG and pha...

Ngày tải lên: 19/02/2014, 07:20

14 630 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... Helena Yusuf-Makagiansar 3 , Vincent T. K. Chow 2 , Teruna J. Siahaan 3 and Seetharama D. S. Jois 1 1 Department of Pharmacy and 2 Department of Microbiology, National University of Singapore, Singapore; 3 Department ... 10% (w/v) heat- inactivated fetal bovine serum and 100 mgÆL )1 of penicillin/ streptomycin. Caco-2 cells were maintained in minimum essential m edium -a cont...

Ngày tải lên: 19/02/2014, 13:20

14 658 0
w