Establishment of a Co-operation Network of Passive House Promoters (PASS-NET) pptx

... University of Innsbruck. The cooperation covers planning and realisation of the database, as well as the consolidation of the both databases and the unlimited operation of the European database. ... with about 2,000 projects together. Additional integration of small databases of Passnet partners. b. Continuing enlargement of data: Increase of the database with about 1,40...

Ngày tải lên: 17/03/2014, 00:20

... cerevisiae MAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic ... cellu- lar network structure based on stationary experimental data, which is applicable to a network of generalized modules under the assumption that each module con- tains...

Ngày tải lên: 07/03/2014, 21:20

... uses a large-vocabulary tagger (Ratnaparkhi, 1996) as a preprocessing stage may compensate for its smaller vocabu- lary. Also, the main reason for using a smaller vocabulary is the computational ... computationally tractable for large datasets and a good approximation to the theoretically optimal method. The parser which uses this approach outperforms both a genera- tive model and...

Ngày tải lên: 23/03/2014, 19:20

... sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence ... chain and hides a large amount of the hydrophobic surface area. Surface area calculations for the pentamer give a total surface area of  81 000 A ˚ 2 with 30% (...

Ngày tải lên: 19/02/2014, 06:20

... technical support (Acomb et al., 2007), medication assistance (Allen et al., 2006)). These domains bring forward new challenges and issues that can affect the usability of such systems: in- creased ... tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual improvements for dialogue-based computer tutors have been explored in t...

Ngày tải lên: 20/02/2014, 12:20

... three sets of primers: first set, A5 1 (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢),...

Ngày tải lên: 21/02/2014, 03:20

... acyl–enzyme intermediate. Biochemistry 49, 341–346. 3 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for Lol-dependent release of ... Jun-Ho Chae 2 , Naoshi Dohmae 1 , Bok Luel Lee 2 and Hiroshi Nakayama 1 1 Biomolecular Characterization Team, RIKEN Advanced Science Institute, Saitama, Japan 2 National Re...

Ngày tải lên: 06/03/2014, 01:20

... Ioannis Ioannou is an Assistant Professor of Strategic and International Management at London Business School. George Serafeim is an Assistant Professor of Business Administration at Harvard ... sample, we again use proprietary data obtained through SAM. Panel A of Table 3 presents a comparison between the High and Low Sustainability firms across several data items that relate t...

Ngày tải lên: 06/03/2014, 20:21

... Diagnostica Molecolare Avanzata, II Facolta ` di Medicina e Chirurgia, Azienda Ospedaliera S. Andrea, via di Grottarossa, 1035-00189 Roma, Italy Fax: +39 06 33776664 Tel: +39 06 33775457 E-mail: marialuisa.mangoni@uniroma1.it (Received ... fluorescein isothiocyanate–dextran of 4 kDa average molecular mass; FITC-D 10, fluorescein isothiocyanate–dextran of 10 kDa average molecular mass; FITC-...

Ngày tải lên: 16/03/2014, 00:20

... estimation of the maximum distances and classification of cross-peaks as weak, medium and strong. For the calibration of the intensities of the NOE peaks, a statistical analysis of the d aN (i,i+3) ... chain protons. The spin systems of Lys10 and Arg11 are indicated by rectangles as both contain a second H N in the side chain. The N-terminal Gly1 appears as a weak and very br...

Ngày tải lên: 16/03/2014, 16:20