Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt

Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt

Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt

... FEBS MD simulations of the RBP molten globule state E. Paci et al. Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach Emanuele Paci 1 , ... unfolded states of human alpha-lactalbumin by molecular dynamics simulation. J Mol Biol 306, 329–347. 31 Marchi M & Ballone P (1999) Ad...

Ngày tải lên: 16/03/2014, 23:20

13 321 0
Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc

Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc

... Foun- dation. SK was supported by the Maj and Tor Nes- sling Foundation and PR was an Academy Research Fellow of the Academy of Finland. References 1 Baliga BS, Bhatnagar GM & Jagannathan V ... the analysis. The protein content of the extract was estimated using the Bio-Rad protein assay, and c-globulin was used as a standard. Enzyme purification and assays To pur...

Ngày tải lên: 19/02/2014, 06:20

7 510 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

... lower than that of isomaltase, respectively. The K m for a- pNPG of Mun/Bpu was the same a s that of isomaltase, whereas the K m for a- pNPG of M un/Bst was about 50 times l ower than that of isomaltase. ... Val216 decides the substrate specificity of a- glucosidase in Saccharomyces cerevisiae Keizo Yamamoto 1 , Akifumi Nakayama 2 , Yuka Yamamoto 1, * and Shiro Tabata...

Ngày tải lên: 07/03/2014, 16:20

7 452 0
Báo cáo khoa học: "Completing on the partial basis parses of ill-formed sentences of discourse information" docx

Báo cáo khoa học: "Completing on the partial basis parses of ill-formed sentences of discourse information" docx

... what information is available about the AS/400 system. Candidates AJ N V AJ AJ DET N N for the POS AV AV of each word PN PP Phrases what information is available about the appears in sentences ... parser, and a matching pattern with a part of speech rather than an actual word on one side can be regarded as a relaxation rule, in the sense that syntactic and se- manti...

Ngày tải lên: 08/03/2014, 07:20

8 409 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate amplification of the target amplicon was checked by obtaining ... sequencing chemistry. Real-time quantitative PCR Quantitative RT-PCR analysis was performed using the iCycler apparatus (Bio-Rad, Hercules, CA, USA). Total RN...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39–46. 34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y & Kishi ... the molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients with AMI and to validate the use of serum DNase...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... plasma membrane receptor and the activation of the plasma membrane H + -ATPase. IV. Fusicoccin induces the association between the plasma membrane H + -ATPase and the fusicoccin...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH ... min, the absorbance of the supernatant was read at 363 nm. The absorbance of the reduced form of APAD (APADH) was linear over the 2–100 l M range of glutamate with a molar...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, Hirata M, Mazda O, Katsura Y & Narumiya S (1993) Thromboxane A2 receptor is highly expressed in mouse immature thymocytes and mediates DNA fragmentation and apoptosis. ... Grazia U, Felli MP, Vacca A, Farina AR, Maroder M, Cappabianca L, Meco D, Farina M, Screpanti I, Frati L et al. (1994) Positive and negative regulation of the com- posite octamer motif...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... tubingensis (CAA68128.1), Pgx2 Arabi- dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in paren- theses. A question mark indicates ... detail as an extracellular exopec- tate lyase, releasing unsaturated trigalacturonate as the major product [20]. We here report on the overproduc- tion, purification an...

Ngày tải lên: 20/02/2014, 03:20

10 592 0
w