Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... with a Thermal Cycler Dice Real Time System (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse ... reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA- CATGG-3¢ were used for detecting GmPDIL- 3a and GmPDIL-3b, respectively. Primers for quantification of actin mR...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... for the catalytic modules of other polymerases [11]. Furthermore, the conservation of catalytic aspartate residues and their 3D arrangement suggest that the catalysis mode is probably comparable with ... best of our knowledge, Rep245 typifies the shortest functional domain from a crenarchaeal plasmid endowed with DNA and RNA synthesis and terminal transferase activity....
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... 5¢-GACGACGACAAGATGGAG GAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGA AGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ for GmPDIL-1, and 5¢-GACGACGACAAGATGCTCACCGA CGACGAGGACC-3¢ and 5¢-GAGGAGAAGCCCGGTTC ATAATTCATCCTTCACATC-3¢ ... Wadahama H, Kamauchi S, Nakamoto Y, Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc
... TCACTTCTCTCCCTTCCACCA CYP71 9A2 forward GTCGTAATTAATCACTTAACCGTGCTCG CYP71 9A2 reverse GAAAGAAACAGAGCAAATCTTATCCTTTTACC CYP71 9A3 forward CCTCGTAACTAATATACCAGTGTGGTG CYP71 9A3 reverse GACAACCAAGCAAACTCTTATTCTTGTAC Internal control ... underlined): the forward primer (5¢-TTTCC CAAAAGAA ACTAGTAATGG-3¢) and reverse primer (5¢-ATACTAGTGCACGGTTAAGTGATTAATTACG-3¢) for CYP71 9A2 , and the fo...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... 00 Fetuin NeuAca2-3Galb1-3GalNAca1-O-Ser/Thr c 0 1.4 NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thr c NeuAca2-6(3)Galb1-4GlcNAc-R c Asialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83 Galb1-4GlcNAc-R Arylglycosides ... transfer of a sialic acid residue in a2 ,6-linkage to the galactose residue of thetype2disaccharide(Galb1–4GlcNAc) found as a free disaccharide or as a terminal N-acetyll...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf
... CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC T. Ogura et al. Molting ... body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis TES and ovary (OVA),...
Ngày tải lên: 07/03/2014, 21:20
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene (GenBank accession numbers BE590673 and ... purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) oligo- nucleotide primers havi...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf
... reaction times, the refolding mixture was acidified and immediately analyzed by RP-HPLC. The amounts of native and linear tx 3a were calculated from their elution peak areas. The data are the average ... that had similar thermodynamic stability to the native form. We purified sTx3.1 and used it as the cPDI substrate in the isomerase activity assay. The traces b–e in Fig...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
... (5¢-GCAAATGCAACTGGA AGCGG-3¢)andA1(5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢)andA2(5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification of HRT2. The ... Asawatreratanakul 1,2 , Yuan-Wei Zhang 1, *, Dhirayos Wititsuwannakul 3 , Rapepun Wititsuwannakul 4 , Seiji Takahashi 1 , Atiya Rattanapittayaporn 4 and Tanetoshi Koyama 1 1 Institute...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the ... three copies of double stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT...
Ngày tải lên: 08/03/2014, 10:20