Báo cáo khoa học: "The Creation of a Corpus of English Metalanguage" pptx
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conforma- tion, and the two C-terminal domains are cleaved off by heat treatment at 50 °C. An Ala-Pro-Thr ... The Research Council of Norway and Biotec Pharmacon ASA. References 1 Rao MB, Tanksale AM, Ghatge MS & Deshpande VV (1998) Molecular and biotechnological aspects of micro- bial prote...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... thaliana proteins also contain a PAC motif, and conversely that all PAC- annotated A. thaliana proteins contain a PAS domain. Therefore, in the case of A. thaliana,thePASandPAC motifs are inseparable, ... that not all six structures contain a PAS as well as a PAC motif, according to the PFAM database (Fig. 1D and Table 1). Each of the 958 PAS domains was modelled against each o...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... conformational transitions linked to Na + binding Raimondo De Cristofaro 1 , Andrea Carotti 2 , Sepideh Akhavan 3, *, Roberta Palla 3 , Flora Peyvandi 3 , Cosimo Altomare 2 and Pier Mannuccio Mannucci 3 1 ... enzymatic experiments, an increase of % 0.5 pK units of the His57 in DK9 mutant was also calculated analyzing the NAPAP data set (Table 1C). In fact, His57 undergoes Table 1. Best-fit...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... accompanied by a further maturation of epitopes A2 and A5 . After 25 min of chase, precipitation with mAbs A2 and A5 is almost as efficient as with mAb B1. The location of epitopes suggests that ... none of the analysed mutants, however, does treatment with Kif lead to a substantial increase of ASA in the medium. Thus, in case of ASA, inhibition of the degradation pathwa...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... (Invitrogen, Carlsbad, CA, USA), and the two synthesized oligonucleotides P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted ... Sarafian V, Potier M & Poole RJ (1992) Radiation- inactivation analysis of vacuolar H + -ATPase and H + - pyrophosphatase from Beta vulgaris L. Functional sizes for substrate hydrolysis an...
Ngày tải lên: 16/03/2014, 02:20
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx
... influenzae, Streptococcus pneumoniae, Branhamella catarrhalis and the pathogenic fungi Aspergillus fumigatus and Candida albicans, in addition to P. aerugin- osa and S. aureus. A similar antimicrobial ... Chloramphenicol-2-agar plates. The antifungal activity of trappin-2 and its derivative was tested against dormant and activated A. fumigatus con- idia. To prepare dormant (metabolically...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf
... Fatty acid methyl e ster (FAME) analysis, GLC and GLC-MS indicated that the majority of fatty acids contained in Spirochaeta aurantia LGL B are either branched or unsaturated. Values stated a ... as a substrate, and the absorbance was measured at 490 nm by using a Spectramax plate reader and software (Molecular Devices, Sunnyvale, CA, USA). All values were interpolated from either a...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... complementary primers for variant 1V2 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and comple- mentary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and ... 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢. All primers were purchased from ARK/Sigma. The chimeric TAP construct 1V2 was created by ligation...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt
... kinase 6 constitutes an accessorial autoregulatory domain Petra Vatter*, Claudia Stoesser*, Ines Samel, Peter Gierschik and Barbara Moepps Department of Pharmacology and Toxicology, University of ... subfamily, also referred to as the GRK4 subfamily. GRKs share a similar structural organization char- acterized by a centrally located, highly homologous catalytical domain flanked by vari...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: The metabolic role and evolution of L-arabinitol 4-dehydrogenase of Hypocrea jecorina potx
... a phylo- genetic analysis suggests that filamentous fungi have formed a separate branch of SDHs which are especially adapted to the reductive catabolism of hemicellulose monosaccharides available ... a xdh1/lad1 double deletion mutant on L -arabinose, L -arabinitol and some other hexitols. (A) Growth of H. jecorina on L -arabinose (Ara) and L -arabinitol (Aol) as carbon source on p...
Ngày tải lên: 07/03/2014, 15:20