Báo cáo khoa học: Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function pptx

... Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function Hiroshi Suganuma 1 , Maki Kumada 1 , Toshinori Omi 1 , Takaya Gotoh 1 , Munkhtulga Lkhagvasuren 1 , Hiroshi Okuda 1,2 , ... 5¢-CTGGTCGCAGCTTAGG AACAG-3¢ and antisense, 5¢-AATGTTCATGGGGCGGC CATC-3¢, for RH: sense, 5¢-GCAACGATACCCAGTTT GTC-3¢ and antisense, 5¢-AGTTGACACTTGGCCAGA AC-3¢. The rela...

Ngày tải lên: 16/03/2014, 19:20

... similar to the forward one and it is thus omitted. The alternative calls of forward and backward passes (in Algorithm 1) ensure the alternative updat- ing/lowering of node forward and backward ... same accuracy. The accu- racy we get for the first four tasks is comparable to the state-of-the-art. We do not have a baseline to compare with for the last dataset as it is not pub- licly avail...

Ngày tải lên: 16/03/2014, 19:20

... probabilities and the probability of the path at starting at (a) . In all of the data considered, the frequency of spaces was far higher than that of any other char- acter, and so in any real application ... re- trieval and data mining, in which case it is impor- tant to be able to read through them automatically, without resorting to a human annotator. The holy grail in this area would be...

Ngày tải lên: 17/03/2014, 00:20

... Bando R, Hieda N & Toraya T (2004) Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonia lyase. J Bacteriol 186, 6845–6854. 27 Baker JJ & Stadiman ... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound and nuc...

Ngày tải lên: 15/02/2014, 01:20

Ngày tải lên: 16/02/2014, 15:20

... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from human placenta. J Biol Chem 253, 1766–1772. 22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... Clinical Biochemistry, AS Aarhus University Hospital, Denmark Cobalamin (Cbl, vitamin B 12 ) is a cofactor for two crucial enzymes in mammals [1]. Therefore, an enhanced influx of the vi...

Ngày tải lên: 19/02/2014, 05:20

... Healthcare). Caspase 9 activity assay Caspase 9 activity was examined according to the instruc- tion manual of the Caspase 9 ⁄ Mch6 Fluorometric Protease Assay kit (Medical and Biological Laboratories ... Bcl-X L expression, and the resistance against ADR-induced apop- tosis, suggesting that EGF transmitted the antiapoptotic signal in such a way that it activated AP1 via a MAP kinase sign...

Ngày tải lên: 19/02/2014, 06:20

... GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT. The resulting vector was termed pTrc9 9a: :era. Protein overexpression was assayed by...

Ngày tải lên: 06/03/2014, 00:21

... acid (FA) is a bacteriostatic antibiotic that locks elongation factor G (EF-G) on the ribosome in a post-translocational state. It is used clinically against Gram-positive bacteria such as pathogenic ... & Andersen GR (2003) Two crystal struc- tures demonstrate large conformational changes in the eukaryotic ribosomal translocase. Nat Struct Biol 10, 379–385. 30 Al Karadaghi S, Aevar...

Ngày tải lên: 06/03/2014, 22:21

... Human mitochondrial transcription factor A (mtTFA): gene structure and characterization of related pseudogenes. Gene 291, 223–232. 4 Tominaga K, Hayashi J, Kagawa Y & Ohta S (1993) Smaller isoform of human ... T, Muta T, Ukaji K, Abe Y, Nakay- ama H, Takio K, Hamasaki N & Kang D (2003) Human mitochondrial DNA is packaged with TFAM. Nucleic Acids Res 31, 1640–1645. 16 Takamatsu...

Ngày tải lên: 07/03/2014, 05:20