... (5¢-to3¢) Used for Zfstat6-F1 AGTGAGATGGATACAGGTGCTAAAC Initial PCR Zfstat6-R1 TCTGGACCTCAGACATGAACTTACT Initial PCR Zfstat6-F2 TGTCAGTCCTCTTTAATGCT Initial PCR Zfstat6-R2 AATGGTATCCTGTTTGGCTCAG ... Real-time PCR ZFil4-R TTCCAGTCCCGGTATATGCT Real-time PCR ZFmx-F TGAGTTACACGTTCAGTCAGCAATATG Real-time PCR ZFmx-R TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time PCR ZFifnc-F AAGATTCTCAGCTACATAATGCACACC ....
Ngày tải lên: 16/02/2014, 09:20
... [21]. The DPE is known to act in conjunction with the Inr in the initiation of transcription. A potential AP-1 (activator protein-1) site is located at position ) 78 ⁄ ) 72. Interestingly, there ... effects on the SmSmad1B–SmSmad4 interaction has yet to be determined. The important point is that the constitutively active receptor did not enhance the SmSmad1B–SmSmad4 interaction, similar...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... (ACGCTCACTGGAACACT GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG GAATGCCTCTAG) upstream of the thymidine-kinase promoter of reporter plasmid pUTK-Luc vector, which contains a firefly ... and the signature sequence of the LBD (Ts) starts at amino acid 513 (Fig. 1B). The end of the hinge region to Ts is usually 40 amino acids in most NRs, and the length o...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... part of the basal transcriptional apparatus, such as the TATA box, centered at )27 from the transcriptional start site, and the BRE motif, targets for the general transcrip- tion factors TBP and ... capacity to serve as an antioxidant enzyme. One of the most widely used test for detecting Prx activity is the ability to pro- tect plasmids against the metal catalysed oxidation (MCO) sys...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... AACGAGgtaggc 35209 ttacagGTTTCT 2a 2435 ATCAAGgtaaga 16864 ctgcagGCTGTG 2b 383 ACACAGgtttga 3629 ttttagATTCAA 3 267 GCAAAGgtaatg 13760 ttgcagGTCTGT 4 104 GAGAAAgtaagt 8296 ttatagGTTGCT 5 103 CTTCAGgtaatt ... CTTCAGgtaatt 185761 tttcagGATGTG 6 75 ACCACGgtaggc 7814 aaccagGTTATT 7 87 TTGCAAgtatgc 3811 tttcagACCCTA 8 157 ACCAGGgtaagt 5461 atttagCTTCAT 9 49 AACAAGgtaaga 2646 ctttagGGGAAA 10 90 TAC...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification and characterization of plasma kallikrein–kinin system inhibitors from salivary glands of the blood-sucking insect Triatoma infestans pptx
... kallikrein–kinin system, leading to inhi- bition of the intrinsic coagulation pathway. Triafestin inhibits FXII and PK reciprocal activation and bradykinin generation To investigate inhibition of the ... results were obtained with triafestin-2 (data not shown). PK and kallikrein did not interact with both triafestins (data not shown). To evaluate the binding kinetics, interactions b...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt
... other cysteine proteinases or isoforms. In contrast to the cysteine proteinases pre- sent in papaya latex, which have been extensively studied, very little is known about the cysteine proteinases of ... proteinases (and not the proteinase inhibitors) stored in the laticifers of papaya are the active compounds in its defence against herbivorous insects. Caricaceae latex contains h...
Ngày tải lên: 07/03/2014, 11:20
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc
... characterized wild water- melon glutamate N-acetyltransferase (CLGAT) that catalyses the trans- acetylation reaction between acetylornithine and glutamate to form acetylglutamate and ornithine, thereby ... detect similar AOD activity in the extract of E. coli to that reported in the literature [11], demonstrating that the assay procedures were valid for detecting AOD activity. The u...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... jacquemontii (Rathbun). Hemagglutination activity with different mam- malian erythrocytes suggested a strong affinity of the serum agglutinin for horse and rabbit erythrocytes. The most potent inhibitor of hemagglutination ... Paratelphusa lectin agglutinated only a limited range of erythrocytes. Out of 12 erythrocyte types tested the lectin could agglutinate only six erythrocyte types...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... approach. It seemed reasonable to assume that the immediate environment of the N-phosphate of protein-bound phosphohistidine can in uence its sensitivity to a phosphatase. Of potential interest in such ... predicted sequence. The MS-data, collected under standard condi- tions for obtaining the protein mass, did not indicate the existence of any cofactors tightly bound to the enzyme...
Ngày tải lên: 21/02/2014, 01:21