Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

... well as practical advice on isolation and assay of plantenzymes and extraction of metabolites. It should bementioned that plants pose particular challenges as far asanalysis of their metabolism ... o f sucrose accumulationand also improve our understanding of sugarcane SuSyand its inﬂuence on sucrose accumulation.Materials and methodsMaterials Sugarcane (Saccharum spp. hybrids), variety ... estimateswere calculated automatically by the program based onlinear r egression of r earranged data. U niform weighting wasused for all data points. Kinetic p arameters o ther than the substrate...

Báo cáo khoa học: A kinetic study of a ternary cycle between adenine nucleotides pptx

... presence of an smallamount of ADP and AMP due to a contamination of ATP and NADH standard solutions (data not shown).It can be seen that at the end of the reaction, peakscorresponding to ATP and ADP ... constants for a ﬁxed adenylate energy charge value and viceversa.AbbreviationsACS, S-acetyl coenzyme A synthetase; AEC, adenylate energy charge; AK, adenylate kinase; LDH,L-lactate dehydrogenase; ... Quı´mica-Fı´sica, Escuela Polite´cnica Superior de Albacete, Universidad de Castilla-La Mancha, Albacete, Spain2 Departamento de Bioquı´mica y Biologı´ a Molecular A, Facultad de Biologı´ a, ...

Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc

... mRNA accumulation in transgenic Arabi-dopsis thaliana. Plant Cell Physiol. 42, 1174–1180.46. Hacham, Y., Avraham, T. & Amir, R. (2002) The N-terminalregion of Arabidopsis cystathionine gamma -synthase ... Dumas, R., Ravanel, S. & Douce, R. (1996) Char-acterization of an Arabidopsis thaliana cDNA encoding anS-adenosylmethionine-sensitive threonine synthase. Threonine synthase from higher plants. ... of orthophosphate and adenosine 5¢-phosphate onthreonine synthase and cystathionine gamma -synthase of Lemnapaucicostata Hegelm. 6746. Plant Physiol. 81, 577–583.18. Ravanel, S., Job, D. &...

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... sta-tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large number of features. The challenge of parameter estimation ... investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of these estimators to two additional tasks ... studies claim advantages for L1 regularization, this study is the first of which we are aware to systematically compare it to a range of estimators on a diverse set of NLP tasks. Gao et al. (2006)...

Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

... Study of Opinion Summarization in ConversationsDong Wang Yang LiuThe University of Texas at Dallasdongwang,yangl@hlt.utdallas.eduAbstractThis paper presents a pilot study of opinionsummarization ... somewhat against,strongly against. Therefore for each conversation,we have an abstractive summary, an extractive sum-mary, and an overall opinion for each speaker. Thefollowing shows an example ... Opinion]Somewhat againstTable 2 shows the compression ratio of the extrac-tive summaries and abstractive summaries as well astheir standard deviation. Because in conversations,utterance length varies a...

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 941–948,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP A Comparative Study of Hypothesis Alignment and ... Hypothesis alignment: all hypotheses are word-aligned to the corresponding backbone in a many-to-one manner. We apply four word alignment methods: GIZA++-based, TER-based, CLA-based, and IHMM-based ... total. We selected 360K sen-tence-pairs that are more similar to BTEC data according to its sub-topic. Additionally, the Eng-lish sentences of Tanaka corpus2 were also used to train our language...

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... i.e. a disconnected MDP. This can beavoided by making sure that each action is avail-able at some state and that each state has at leastone available action. We should now deﬁne thenecessary ... withPt(dj|di, a m) ∈ [1 − , 1], with varying  andavailable action density values. At each run, eachalgorithm was evaluated using the same transitionprobabilities and available actions. To assess ... ”Demokritos”,Institute of Informatics& TelecommunicationsandUniv. of Texas at Arlington,Comp. Science and Engineeringalexandros.papangelis@mavs.uta.eduAbstractAdaptive Dialogue Systems are rapidly...

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... Ghosh S, Bhattacharyya N,Ray M & Ray S (2006) In vivo assessment of toxicityand pharmacokinetics of methylglyoxal – augmentation of the curative effect of methylglyoxal on cancer-bear-ing ... Vickers TJ & Fairlamb AH (2006)Trypanothione-dependent glyoxalase I in Trypanosomacruzi. Biochem J 400, 217–223.16 Padmanabhan PK, Mukherjee A & Madhubala R(2006) Characterization of the ... methylglyoxal detoxiﬁcation in the African trypanosome isvia the methylglyoxal reductase pathway to l-lactate.AbbreviationsGLO1, glyoxalase I; GLO2, glyoxalase II; TcGLO1, Trypanosoma cruzi glyoxalase...

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1 ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX...

Báo cáo khoa học: A spectroscopic study of the interaction of isoﬂavones with human serum albumin pdf

... Cassidy A (1999) Dietary isoﬂavones:biological effects and relevance to human health. J Nutr129, 758S–767S.3 Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watan-abe SN, Shibuya M & Fukami Y ... increments.Anisotropy of the daidzein bound HSA was measured inthe presence of warfarin and TIB (bind to domain IIA) anddiazepam (marker to domain IIIA, primary fatty acid bind-ing site). Daidzein and ... binding of warfarin and genisteinin HSA.Experimental proceduresMaterialsHuman serum albumin (A- 1653), BSA (A- 7638) warfarin (A- 2250), diazepam, triiodobenzoic acid N-acetyltrypto-phanamide,...

Xem thêm