Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf
... well as practical advice on isolation and assay of plant enzymes and extraction of metabolites. It should be mentioned that plants pose particular challenges as far as analysis of their metabolism ... o f sucrose accumulation and also improve our understanding of sugarcane SuSy and its influence on sucrose accumulation. Materials and methods Materials Sugarcane (Saccharum spp....
Ngày tải lên: 16/03/2014, 18:20
... presence of an small amount of ADP and AMP due to a contamination of ATP and NADH standard solutions (data not shown). It can be seen that at the end of the reaction, peaks corresponding to ATP and ADP ... constants for a fixed adenylate energy charge value and vice versa. Abbreviations ACS, S-acetyl coenzyme A synthetase; AEC, adenylate energy charge; AK, adenylate kinase; LDH,...
Ngày tải lên: 30/03/2014, 10:20
... mRNA accumulation in transgenic Arabi- dopsis thaliana. Plant Cell Physiol. 42, 1174–1180. 46. Hacham, Y., Avraham, T. & Amir, R. (2002) The N-terminal region of Arabidopsis cystathionine gamma -synthase ... Dumas, R., Ravanel, S. & Douce, R. (1996) Char- acterization of an Arabidopsis thaliana cDNA encoding an S-adenosylmethionine-sensitive threonine synthase. Threonine syntha...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... sta- tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large number of features. The challenge of parameter estimation ... investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of these estimators to...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx
... Study of Opinion Summarization in Conversations Dong Wang Yang Liu The University of Texas at Dallas dongwang,yangl@hlt.utdallas.edu Abstract This paper presents a pilot study of opinion summarization ... somewhat against, strongly against. Therefore for each conversation, we have an abstractive summary, an extractive sum- mary, and an overall opinion for each speaker. The followi...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 941–948, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP A Comparative Study of Hypothesis Alignment and ... Hypothesis alignment: all hypotheses are word-aligned to the corresponding backbone in a many-to-one manner. We apply four word alignment methods: GIZA++-based, TER-base...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf
... i.e. a disconnected MDP. This can be avoided by making sure that each action is avail- able at some state and that each state has at least one available action. We should now define the necessary ... with P t (d j |d i , a m ) ∈ [1 − , 1], with varying and available action density values. At each run, each algorithm was evaluated using the same transition probabilities and available act...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... Ghosh S, Bhattacharyya N, Ray M & Ray S (2006) In vivo assessment of toxicity and pharmacokinetics of methylglyoxal – augmentation of the curative effect of methylglyoxal on cancer-bear- ing ... Vickers TJ & Fairlamb AH (2006) Trypanothione-dependent glyoxalase I in Trypanosoma cruzi. Biochem J 400, 217–223. 16 Padmanabhan PK, Mukherjee A & Madhubala R (2006) Characteriz...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCC GGCCTTGCTGGCTACGTTG F-TDPX1 Cys64Ala GGTACTGGCGTTCCCG GCCAACCAGTTCGCCGGTC R-TDPX1 Cys64Ala GACCGGCGAACTGGTT GGCCGGGAACGCCAGTACC F-TDPX1 Cys83Ala AGGTGAAAAGTTT...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf
... Cassidy A (1999) Dietary isoflavones: biological effects and relevance to human health. J Nutr 129, 758S–767S. 3 Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watan- abe SN, Shibuya M & Fukami Y ... increments. Anisotropy of the daidzein bound HSA was measured in the presence of warfarin and TIB (bind to domain IIA) and diazepam (marker to domain IIIA, primary fatty acid bind- ing site...
Ngày tải lên: 23/03/2014, 11:20