... H 2 SO 4 in order to terminate the reaction. This sample was used as a reference in HPLC analysis. The remaining reaction mixture was incubated for 30 min at 30 °C and then terminated in the same way. ... occurred linearly with increasing azole concentrations, reaching a plat- eau at a concentration range similar to that of NHis- P450 mor in these assays. These res...
Ngày tải lên: 07/03/2014, 16:20
... of retinal melatonin into 5-methoxytryptamine is cataly- sed by an eye AAA [27]. However, no clear physiologi- cal function has yet been ascribed to most mammalian AAAs. At a minimum, AAAs are toxicologically ... recombinant enzymes free of albumin and any other AAAs. It was found that there was no fundamental difference in the mechanisms of inhibition and activation for eit...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... R105H-fwd:5¢-GCTAAAAATAA TGGAGC ACTCCATTTTTAGCGCTCGC-3¢ . R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢ Sequence ... rise to an increase in K m . Also, the polarity is changed, and the increase in the size of the side chain may create steric hindrance f...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx
... CTTTGAAGTCAACTTTAAAAGC 3 CTA CCATGGCACCTCCTTCTTCTTTCTCAA 4 GCT GTCGACTTATTTAGTGCATGCTTTATAAACAA 5 CTA CCATGGCCCCCATCTCTTTTAGTCAT 6 GCT GTCGACTCAGTTCGGGCATTGCTCAC B. Altermark et al. Endonuclease ... pBAD ⁄ gIII plasmid, linea- rized and denatured plasmid and intact plasmid. The pBAD ⁄ gIII plasmid was linearized using SalI and dena- tured by incubation at 98 °C in a PCR machine fo...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx
... this reason, we focused on the molecular interactions between SQAGs and the recombinant MCAK. Kinetic parameters via surface plasmon resonance (SPR) analysis of binding between SQAG and MCAK The ... transfered to a poly(vinylidene difluoride) membrane. The membrane was stained with anti-His 6 Ig and alkaline phosphatase. A single band was present that corresponded to...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... consisting of this frag- ment, troponin-T, and TnC activated the ATPase in a Ca 2+ -dependent manner almost as effectively as intact Akazara scallop troponin. Therefore, Akazara scallop troponin ... that the regulatory and Fig. 6. Ca 2+ -regulation of actomyosin-tropo- myosin Mg-ATPase by rabbit (A and C) and Akazara scallop (B and D) reconstituted tropo- nins. The ef...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Kinetic and mechanistic characterization of Mycobacterium tuberculosis glutamyl–tRNA synthetase and determination of its oligomeric structure in solution pptx
... posi- tion of the 3¢-OH end of the cognate tRNA (Eqn 2). amino acid þ ATP $ aminoacyl-AMP + pyrophosphate ð1Þ amino acyl-AMP + tRNA aa $ AMP + aminoacyl tRNA aa ð2Þ Most aaRS catalyse the formation of ... 5¢-AAGAAGAAG CATATGTCACCGTGCCCG ACCAGCTG-3¢ Primer 2: 5¢-AAGAAGAAG CATATGACCGCCACGG AAACAGTCCGG-3¢ The primers introduced NdeI sites (underlined) for clon- ing of the ampl...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf
... Spain RepA is the DNA replication initiator protein of the Pseudomonas plasmid pPS10. It is representative of a family of plasmid replication initiators active in many Gram-negative bacteria, including ... pro- tein [7]. W94 and C160 are each located on one of the Table 2. Fluorescence and FRET parameters of the W94– AEDANS–C160 pair and resulting average inter-p...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... against amoebiasis Dan Sato 1, *, Wataru Yamagata 2 , Shigeharu Harada 2 and Tomoyoshi Nozaki 1 1 Department of Parasitology, Gunma University Graduate School of Medicine, Japan 2 Department of ... a halogenated analog of Met, has been exploited as a therapeutic agent against cancer as well as against infections by protozoan organisms and periodontal bacteria. However, its mec...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf
... 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢,5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢,5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢,5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢,5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢,5¢-GGACT TTGACATAGCGGCCGGTATCGATGC-3¢ and 5¢-GGA TCACTAGCCTTCGCGAGTGTAGACAGAG-3¢, ... giving all matching atoms with an r.m.s. deviation of 0.10 A ˚ , and they made a sharp turn at NAG3. Al...
Ngày tải lên: 15/03/2014, 11:20