Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... Recombinant mutant of surfactant protein C (Eur. J. Biochem. 271) 2085
Structure and potential C- terminal dimerization of a recombinant
mutant of surfactant-associated protein C in chloroform/methanol
Burkhard ... findings based on electrospray
ionization MS data, chemical cross-linking studies, and
CNBr cleavage data.
Keywords: dimerization; NMR sp...
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
... relative decrease in the
number of studies aimed at gaining an understanding
of the structural conformation of chromatin, and the
changes in chromatin structure that accompany gene
activation. Furthermore, ... mechanism operates in
mammalian cells, then KDM 2A may suppress this
pathway and maintain histone acetylation at tran-
scribed CG islands.
It is becoming increasingly...
Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx
... & Faro, C. (2001) Molecular cloning and characterization
of cDNA encoding cardosin B, an aspartic proteinase accumu-
lating extracellularly in the transmitting tissue of Cynara cardun-
culus ... Brassica,
spinach, potato, tobacco, tomato, cardoon, Centaurea
calcitrapa and carnivorous plants such as Nepenthes
[12,30,31,55–69].
Plant APs are either single-chain (cucumber, squash,...
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf
... Kantchev and Ding-Kwo Chang
Institute of Chemistry, Academia Sinica, Taipei, Taiwan, Republic of China
The structure and membrane interaction of the internal
fusion peptide (IFP) fragment of the ... with a coupling t ime of 10 h.
Labelling with NBD was achieved according t he procedure
of Rapaport and Shai [ 13] with modifications as described in
a recent s tudy [14]....
Báo cáo khoa học: Structure and function of KH domains docx
... both amino
acid side-chains and the protein backbone, electro-
static and polar interactions and, to a lesser extent,
hydrophobic interactions between bases and nonaro-
matic amino acid side-chains ... RNA. The tandem KH1–KH2 domains of NusA recognize
RNA ligand 5¢-GAACUCAAUAG. (A) The KH1–KH2 domains of NusA bound to cognate RNA ligand (Protein Data Bank entry 2ASB). The
RNA...
Báo cáo khoa học: Structure and mechanism of the ThDP-dependent benzaldehyde lyase from Pseudomonas fluorescens potx
... by a varying
number of a- helices. Residues involved in binding of
the cofactor ThDP are located at the C- terminal ends
of the b-strands of Dom -c (diphosphates and Mg
2+
)
and of Dom -a of a neighbouring ... and
catalyse a broad range of reactions mainly involving
the cleavage and the formation of C C- bonds. For
instance, they catalyse nonoxidative an...
Báo cáo khoa học: Structure and function of N-acetylglucosamine kinase Identification of two active site cysteines pptx
... ATGAG
C1 31S 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC
TGATGG
C1 43S 5¢-GATGGCTCCGAGAGTGGCAGTGGAGGCTGGGG
C2 11S 5¢-CCCATTTGTATAGGGACTTTGATAAAAGTAAG
TTTGCTGGATTTTGCCAGAAAATTGC
C2 17S 5¢-GCTGGATTTAGTCAGAAAATTGCAGAAGGTG
CACATCAGGG
C2 68S ... kinase
C1 29
Glucokinase
(a- helix); C1 31
GlcNAc kinase
– C2 33
Glucokinase
(b-sheet); C1 43
GlcNAc kinase
– C2 52
Glucokinase
(b-sheet); C2 11
GlcNA...
Báo cáo khoa học: "STRUCTURE AND INTONATION IN SPOKEN LANGUAGE UNDERSTANDING*" pptx
... therefore interesting to observe that all natu-
ral languages include
syntactic
constructions whose
semantics is also reminiscent of functional abstrac-
tion. The most obvious and tractable class ... unconstrained combina-
tory grammar would in fact allow any bracketing on
a sentence, although the grammars we actually write
for configurational languages like English are heavily...
Báo cáo khoa học: Structure and topology of the transmembrane domain 4 of the divalent metal transporter in membrane-mimetic environments docx
... porcine galanin in SDS micelles: Comparison with an
inactive analog and a galanin receptor antagonist. Biochemistry
25, 9169–9178.
38. Wu
¨
thrich, K. (1986) NMR of Proteins and Nuclear Acids. ... trifluoroacetic acid/water and 0.1% (v/v)
trifluoroacetic acid/acetonitrile as solvents (Biopeptide
Co., LLC. San Diego, CA, USA). The purity was assessed
by both mass spectrometry and a...
Tài liệu Báo cáo khoa học: "Opinion and Generic Question Answering Systems: a Performance Analysis" ppt
... formulated and
annotated of a set of questions and answers over
a multilingual blog collection. A further contri-
bution is the evaluation and comparison of two
different approaches to QA a fact-oriented ...
involved in a mixed fact and opinion question
answering setting by comparing the perform-
ance of two Question Answering (QA) sys-
tems as far as mixed opi...
Từ khóa: