Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp SIB1 in cold-adaptation potx
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
... family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation Yutaka Suzuki, Mitsuru Haruki*, Kazufumi Takano, Masaaki Morikawa and Shigenori Kanaya Department of ... of Material and Life Science, Graduate School of Engineering, Osaka University, Japan A psychrotrophic bacterium Shewanella sp. strain SIB1 was grown at 4 an...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... necessary lex- icon for an average application is generally large (hundreds to thousands of words) and most lexical information is not transportable across domains. The problem of lexicon transport ... the FL. In general the quantity of application specific information is small. Any machine readable dictionary can be to some ex- tent seen as a BL. The transport of BL to ne...
Ngày tải lên: 08/03/2014, 21:20
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt
... MaL, Melanocarpus albomyces laccase; PDB, Protein Data Bank; RlL, Rigidoporus lignosus laccase; rMaL, recombinant Melanocarpus albomyces laccase; TaLcc1, Thielavia arenaria laccase; ThL, Trametes ... asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data Bank database under the accession numbers 3PPS and 2VDZ Structured digital abstrac...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from which an average distance of 2.03 A ˚ for Fe–N(His) was inferred [38], and a target distance of ... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD an...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx
... PCR using a pair of oligonu- cleotides, 5¢-GAGCTCGAAGGAGATATAAATATGAAT AAGATCCTGTTGCAATGC-3¢ and 5¢-AAGCCTGCAG TTTTTGTTCCACCAATATCAAACCC-3¢. The amplified DNA was digested with SacI and PstI, and ... C-terminus, PCR was performed with pJY310 as a template and a pair of oligonucleotides, 5¢-GATGAATTCGGAGGTTTAAATTTATGGCGATGC CTTTATCGTTATTAA-3¢ and 5¢-CAATTCAAGCTTAA TGATGATGATGATGATGCTC...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: The involvement of human ribonucleases H1 and H2 in the variation of response of cells to antisense phosphorothioate oligonucleotides pot
... Y. & Bambara, R .A. (1994) Enzymatic completion of mammalian lagging-strand DNA replication. Proc. Natl Acad. Sci. USA 91, 9803±9807. 25. Kurosawa,Y.,Ogawa,T.,Hirose,S.,Okazaki,T.&Okazaki,R. (1975) ... cancer), MiaPacaII (pancreatic carcinoma), T24 (bladder carcinoma), HeLa (cervical carcinoma) and HTB82 (rhabdomyosarcoma), were obtained from the American Type Culture Collection,...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot
... target for thera- peutics aimed at cancer and leukemia. EPHA3 is involved in neural and retinal development in mam- mals, and was originally described as a determinant of Keywords ephrin kinase; ... [12–14], and in glioblastoma, melanoma and rhabdomyosarcoma cell lines, among others [15,16], suggesting that the EphA3 kinase domain is an attractive candidate for drug development i...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: "The Parameters of an Operational Machine Translation System" doc
... human translation for that matter, is the effective transference of mean- ing from one language to another. To satisfy ourselves that this transference of meaning was in fact taking place, an ... to warrant opera- tional machine translation production from Russian- language materials, I do not wish to suggest that all problems in the transference of meaning from one...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot
... 3¢) SaOP1-F01 CGCTCCAGCCGCTGAACTCCTGAAGC SaOP2-F02 CCACCCCTCAGCCCATCGACCCTACC SaOP3-F03 GGCGGGACCTGACACCACCACTGACA SaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGG SaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV ... AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAA SaRPL2 7a- FW AAGAGGAACACAACTCACTGCCCCAC SaRPL2 7a- RV GCTTGCCTTTGCCCAGAACTTTGTAG Fig. 1. SaOP-L full-length cDN...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx
... Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein Cristina Lanni, Michela Mazzucchelli, Emanuela Porrello, Stefano Govoni and ... to basal levels and reached a maximum of approximately threefold increase at 1 00 n M PMA. In contrast SYDe showed a slight and not significant increase in sAPPa relea...
Ngày tải lên: 23/03/2014, 13:20