Báo cáo khóa học: Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody pdf
... 417 Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody Role in human renal glomerular binding Davin Chark 1,2 , Anita Nutikka 1 , Natasha Trusevych 1,3 , ... 0.05%, extraction delay time of 175 nsec and low mass gate at 800 Da. The mass spectra were externally calibrated with the molecular mass of a...
Ngày tải lên: 16/03/2014, 16:20
... phosphatase 2A. Biochemis- try 35, 6998–7002. 7 Radrizzani M, Vila-Ortiz G, Cafferata EG, Di Tella MC, Gonzalez-Guerrico A, Perandones C, Pivetta OH, Carminatti H, Idoyaga Vargas VP & Santa-Coloma ... interaction was mapped onto the LRR and AXH domain of Anp32 and Atx1 respectively, and was shown to be stronger for expanded Atx1 [16,18]. The temporal and cell-specific expression...
Ngày tải lên: 18/02/2014, 17:20
... with an equal volume of 7 m urea ⁄ 20 mm EDTA and immediately frozen on dry ice. In vitro RNA aptamer dimerization assay Aliquots of 5¢ labeled RNA aptamers, supplemented with unlabeled RNA to a ... EDTA). Patterns of I 2 cleavage were compared on 8 m urea ⁄ 12% polyacrylamide gel alongside alkaline hydrolysis ladders and partial digestion with RNase T 1 . Products were visualized...
Ngày tải lên: 16/03/2014, 06:20
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... taken from [44]. Chicken H101 a- STAAPP AmKA K A K A T K K K 2m ⁄ fKK dNK H110 a- STAAPA AK A K A K AT K KK 2m ⁄ fKK dNK H102 a- STAAPS AK A K P K ATK KK 2m ⁄ fKK dNK H103 a- A pTAAPA AK A K A K ATK ... DK H1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aK H1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afK H1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... chains of Asp76 (1.9 A ˚ ) and Asp27 (2.4 A ˚ ) of a symmetry-related molecule and four water molecules (1.9 A ˚ , 2.1 A ˚ , 3.1 A ˚ and 3.0 A ˚ ) coordinate the cation with an approximate octahedral ... ratios: at a 1 : 1 Fe 2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disap- peared, and the resonance of Leu21 shifted. At a 2 : 1 ratio, the...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... conserved among many organisms, such as mammals, plants, worms, and bacteria [4,12]. A variety of molecular functions of PEBPs in mammals have been reported to date, and include the association with ... Tokyo, Japan) equipped with U-MNIBA2 and U-MWIG2 mirror units (Olympus), a digital charge-coupled device camera C4742-95–12ER (Hamamatsu Photonics, Hamamatsu, Japan), and aqua-...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: "The grapho-phonological system of written French: Statistical analysis and empirical validation" pdf
... delayed naming task were eliminated. Latencies outside an interval of two standard deviations above and below the mean by subject and condition were replaced by the corresponding mean. Average ... reaction times and error rates were then computed by subjects and by items in both the immediate naming and the delayed naming task. By- subjects and by- items (Ft a...
Ngày tải lên: 20/02/2014, 19:20
Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot
... 5¢-TGGATCAATCTCAAATGCATT ACACTACGAGCACGCGACCAGACTTAAAGCCTACC TTCTGTG-3¢ and for HGAL-mutant#2: 5¢-TATAAA AATTTGTACACACAGTCTTAGAGGACATACGTGTG TCGTGGCTAAATGCCTAGGAGTGAAATTGC-3¢ and 5¢-GCAATTTCACTCCTA ... (Stratagene, La Jolla, CA, USA). Primers used for mutagenesis with mutations in lower case are HGAL-mutant#1: 5¢-CACAGAAGGTAGGCTTTAAG TCTGGTCGCGTGCT CGTAG TG TAATG CATTTG AGA TTGATCCA-3¢ a...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Distinguishing between different pathways of bilayer disruption by the related antimicrobial peptides cecropin B, B1 and B3 pptx
... melittin, alamethicin and magainin [44,45]. In this study, we examined and compared the disruptive mechanisms of the natural peptide (CB) and the custom peptide analogues (CB1) and (CB3) against ... production of cationic antimicrobial peptides is probably a survival strategy to obtain an ecological advantage over competitors [8–10]. In invertebrates and plants, which lack the...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf
... PI3- kinase/AKT and STAT3 activation pathways, LIFR/gp130 signaling is also kn own to implic ate the GRAB2/Sos adaptators and regulate the MAP kinase pathway [54–56]. ERK1 and ERK2, involved in the MAP kinase ... Analysis of the downstream signaling events revealed the recruitment by CC–FP of the signal transducer and activator of tran- scription (STAT)-3, Akt and mitoge n-a...
Ngày tải lên: 08/03/2014, 10:20