Báo cáo khóa học: Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody pdf

... 417 Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody Role in human renal glomerular bindingDavin Chark1,2, Anita Nutikka1, Natasha Trusevych1,3, ... 0.05%,extraction delay time of 175 nsec and low mass gate at800 Da. The mass spectra were externally calibrated withthe molecular mass of a mixture of standard peptides.ResultsComparison of ligand/Gb3binding ... Chongsa-nguan, M. &Chaicumpa, W. (2001) Localization of Shiga toxins of entero-haemorrhagic Escherichia coli in kidneys of paediatric and geriatric patients with fatal haemolytic uraemic...

Tài liệu Báo cáo khoa học: Structural bases for recognition of Anp32⁄LANP proteins doc

... phosphatase 2A. Biochemis-try 35, 6998–7002.7 Radrizzani M, Vila-Ortiz G, Cafferata EG, Di TellaMC, Gonzalez-Guerrico A, Perandones C, Pivetta OH,Carminatti H, Idoyaga Vargas VP & Santa-Coloma ... interaction was mapped onto the LRR and AXH domain of Anp32 and Atx1 respectively, and was shown to be stronger for expanded Atx1[16,18]. The temporal and cell-speciﬁc expressionpattern of Anp32 ... Titration was carried out by stepwise additions of a 0.87 mm stock solution of Anp3 2a LRR domain up to a 60 : 1 ratio. The data were evaluatedusing the origin program package (Micro-Cal Software,Bletchley,...

Báo cáo khoa học: Structural basis for recognition of Co2+ by RNA aptamers pot

... with an equal volume of 7 m urea ⁄ 20 mmEDTA and immediately frozen on dry ice.In vitro RNA aptamer dimerization assayAliquots of 5¢ labeled RNA aptamers, supplemented withunlabeled RNA to a ... EDTA).Patterns of I2cleavage were compared on 8 m urea ⁄ 12%polyacrylamide gel alongside alkaline hydrolysis ladders and partial digestion with RNase T1. Products werevisualized by autoradiography ... RNA chain, and I2cleavageallows determination of the atom in the bases thatinterferes with function [14,15]. NAIM has been usedto identify the RNA ligands that interact with metalions and...

Tài liệu Báo cáo khoa học: Post-translational modiﬁcations of the linker histone variants and their association with cell mechanisms docx

... taken from [44].ChickenH101 a- STAAPP AmKA K A K A T K K K 2m ⁄ fKK dNKH110 a- STAAPA AK A K A K AT K KK 2m ⁄ fKK dNKH102 a- STAAPS AK A K P K ATK KK 2m ⁄ fKK dNKH103 a- A pTAAPA AK A K A K ATK ... DKH1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aKH1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afKH1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a K ufKK a ⁄ mKN afKH1.4 a- pS pTAAPK pTKKK ... pSS auK aK fK aKK NaKH1.3 a- STAAPaK pTKKK RaK pSS auK aK fK a KK NaKH1.4 a- STAAPaK pTKKA RaK pSS auK aK fK aKK NaKH1.5 a- pST A E P aK pSKKK RK TSaK K K K K N afKChickenH101 aKKR RTAaKK pSKKTKK...

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

... chains of Asp76 (1.9 A ˚) and Asp27(2.4 A ˚) of a symmetry-related molecule and four watermolecules (1.9 A ˚, 2.1 A ˚, 3.1 A ˚ and 3.0 A ˚) coordinatethe cation with an approximate octahedral ... ratios: at a 1 : 1 Fe2+⁄ protein ratio,the resonances of Arg20, Asp22 and Asp23 disap-peared, and the resonance of Leu21 shifted. At a 2 : 1ratio, the resonances of residues 19 and 44 also ... sphere of M3 is completed by three other water molecules at distances of 1.6, 2.0 and 1.8 A ˚, respectively, and by the carboxylate oxy-gens of Asp31 (2.1 A ˚) and of Asp29 (2.7 A ˚). The twoaspartate...

Tài liệu Báo cáo khoa học: Speciﬁc membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... conservedamong many organisms, such as mammals, plants,worms, and bacteria [4,12]. A variety of molecularfunctions of PEBPs in mammals have been reported todate, and include the association with ... Tokyo, Japan) equipped withU-MNIBA2 and U-MWIG2 mirror units (Olympus), a digital charge-coupled device camera C4742-95–12ER(Hamamatsu Photonics, Hamamatsu, Japan), and aqua-cosmos 2.0 software ... phase was selectively relocalized atthe vacuolar membranes and lumens during the station-ary phase.DiscussionPEBP from bovine brain, a mammalian homolog of IC,was originally isolated as...

Tài liệu Báo cáo khoa học: "The grapho-phonological system of written French: Statistical analysis and empirical validation" pdf

... delayed naming task were eliminated. Latencies outside an interval of two standard deviations above and below the mean by subject and condition were replaced by the corresponding mean. Average ... reaction times and error rates were then computed by subjects and by items in both the immediate naming and the delayed naming task. By- subjects and by- items (Ft and F2, respectively) analyses ... First, grapheme-phoneme associations are tabulated for all trivial cases, that is, words which have exactly the same number of graphemes and phonemes (i.e. PAR,/paR/). Then a segmentation algorithm...

Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot

... 5¢-TGGATCAATCTCAAATGCATTACACTACGAGCACGCGACCAGACTTAAAGCCTACCTTCTGTG-3¢ and for HGAL-mutant#2: 5¢-TATAAAAATTTGTACACACAGTCTTAGAGGACATACGTGTGTCGTGGCTAAATGCCTAGGAGTGAAATTGC-3¢ and 5¢-GCAATTTCACTCCTA ... (Stratagene, La Jolla, CA, USA).Primers used for mutagenesis with mutations in lower caseare HGAL-mutant#1: 5¢-CACAGAAGGTAGGCTTTAAGTCTGGTCGCGTGCT CGTAG TG TAATG CATTTG AGATTGATCCA-3¢ and ... GGCATTTAGC CAC GACACACGTATGTCCTCTAAGACTGTGT GTACAAATTTTTATA-3¢.Transfections and luciferase assaysNon-Hogdkin’s lymphoma cell lines were transfected by electroporation using either a BioRad...

Báo cáo khoa học: Distinguishing between different pathways of bilayer disruption by the related antimicrobial peptides cecropin B, B1 and B3 pptx

... melittin, alamethicin and magainin [44,45].In this study, we examined and compared the disruptivemechanisms of the natural peptide (CB) and the custompeptide analogues (CB1) and (CB3) against ... production of cationicantimicrobial peptides is probably a survival strategy toobtain an ecological advantage over competitors [8–10]. Ininvertebrates and plants, which lack the adaptive immunesystem ... structurallyrelated antimicrobial peptides cecropin B, B1 and B3,revealed by surface plasma resonance analysis of immobi-lized liposomes, diﬀerential scanning calorimetry of peptide–large unilamellar...

Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf

... PI3-kinase/AKT and STAT3 activation pathways, LIFR/gp130signaling is also kn own to implic ate the GRAB2/Sosadaptators and regulate the MAP kinase pathway [54–56].ERK1 and ERK2, involved in the MAP kinase ... Analysis of the downstream signaling events revealed the recruitment by CC–FP of the signal transducer and activator of tran-scription (STAT)-3, Akt and mitoge n-activated protein(MAP) kinase ... was bought from Upstate Biotech-nology (Lake Placid, NY, USA) and the 9E10 antic-myc epitope mAb was obtained from the ATCC (Rockville,MD, U SA). The antibody raised against STAT3 waspurchased...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP