Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... 2387 Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis Puja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... theabnormal accumulation of intracellular acyl-CoA. We have isolated a thioesterase from Alcaligenes faecalis ISH108 and demonstrated its application inchemoselective and racemization free deacylation ... et al. Thioesterase of Alcaligenes faecalis FEBS Journal 273 (2006) 2374–2387 ª 2006 IMTECH 2383reduced afﬁnity and decreased catalytic efﬁciency of thioesterase for unsaturated fatty acyl-CoA...

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel speciﬁcity towards C-terminal glutamate residues pptx

... wereroutinely reared on the standard artiﬁcial diet described byBown et al.[12].Puriﬁcation and characterization of carboxypeptidases from H. armigeralarval gut extractGut extract was prepared from ... andanalysed by SDS/PAGE.Carboxypeptidase assays and expression of HaCA42 mRNACarboxypeptidase assays using the synthetic substratesfurylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys(FAAK) ... of C-terminal aspartate also observed. Glutamate carboxyp-eptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the ﬁrst glutamate-speciﬁc metallocarboxypeptidase...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-ampliﬁed ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Marchese, S., Brandazza, A. ,Ferrara, L., Pelosi, P. & Scaloni, A. (2001) Bacterial expressionand conformational analysis of a chemosensory protein from Schistocerca gregaria. Eur. J. Biochem....

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... is an economically important s pecies, in particularbecause of i ts propagation on a large scale a nd utilizationfor silk production.Here, we describe the isolation and characterization of a novel ... Technology and Medicine, London SW7 2AZ, UK;2Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, JapanSugar conjugation is a major pathway for the inactivationand excretion of both ... project. A wing disc cDNA library derived from ﬁfth instar B. mori C108 larvae was kindly providedby Dr Kawasaki (University of Utsunomiya, Japan). A total of 1000 clones were s elected at random and...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase from Saccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... 182–191.26 Altschul SF, Madden TL, Schaffer AA, Zhang J,Zhang Z, Miller W & Lipman DJ (1997) GappedBLAST and PSI-BLAST: a new generation of proteindatabase search programs. Nucleic Acids Res ... the calculated molecu-lar mass of 72.3 kDa determined from the translatedamino acid sequence. However, the ScPPDC samplewas clearly larger than an authentic sample of BFDC from P. putida (57.4...

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... Purandare AV, Chen Z, Huynh T, Pang S, Geng J,Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar-aman L (2008) Pyrazole inhibitors of coactivator associ-ated arginine methyltransferase 1 (CARM1). ... transcription,protein and RNA subcellular localization, RNAsplicing, DNA damage repair, and signal transduction[2]. Nine PRMT family members have been clonedand characterized to date, with putative 10th and ... PRMTreaction, the use of SAM analogs is a logical strategyfor the direct inhibition of PRMTs. As a SAM analog,sinefungin can compete for SAM binding and inhibitthe activity of all SAM-dependent...

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) Theamino acid sequence of the beta chain of ... importantly, two localmaxima of  330 and 380 nm were also revealed.These maxima are typical of diiron-centre absorbance,and thus characteristic for all haemerythrins [12]. Thisstrongly indicates ... N-terminally or MS-identiﬁed spots.Approximate molecular masses and pI values are indicated to the left and at the top of the gels, respectively. Characterization of prokaryotic haemerythrin O. A. ...

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... speciﬁc radioactivity of the125I-labelledPA1b, calculated by the ratio of the radioactivity measuredby gamma counting and the amount of peptide evaluated byabsorbance at 210 nm during HPLC analysis, ... PA1b: ﬁve susceptiblestrains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamaisLS, and S. granarius BrayardÕ and four fully resistantS. oryzae strains ÔISOR3, Mex1, China and GVÕ harboring a ... Instrument,USA), and each point was the mean of triplicates. Bindingdata were analyzed using the RADLIG 4 software (BIO-SOFT, Cambridge, UK), and plots were drawn using theORIGIN 5 software (Microcal,...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM