Báo cáo khoa học: Identification of RNase HII from psychrotrophic bacterium, Shewanella sp SIB1 as a high-activity type RNase H pot

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... doi:10.1111/j.1432-1033.2004.03980.x molecular dynamic modelling as well as biophysical analy- ses have revealed the mechanisms that ensure very rapid transport and at the same time high selectivity of water or glycerol transport ... is an atypical aquaglyceroporin as the highly conserved NPA motifs in the B- and the E-loop are NPS (Asn-Pro-Ser) and NLA (Asn-Leu-Ala), respectively, se...

Ngày tải lên: 07/03/2014, 15:20

9 383 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... stop assay This assay was adapted from the method described by Han et al. [43]. The 25-mer primer was 5¢-labeled with 32 P, mixed with the 76-mer template DNA and annealed as described above. The ... at 1 n M, whereas the concentration of RNase- treated RGG3 added to the binding reaction was varied, as shown above each lane. The equilibrium-binding curve was obtained by calculating t...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... TGC TTG ATG AGC CTA CCA (atr sense) This study atr2 TGC TGA TGA TGG CAA CTC (atr antisense) This study asd1 AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) ... P, Jansson PE, Rahman MM, Widmalm G, Holme T, Rahman M & Weintraub A (1994) Structural studies of the O-polysaccharide from the lipopolysac- charide of Moraxella (Branhamella) cat...

Ngày tải lên: 18/02/2014, 14:20

14 675 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 ... kinase complex-associated protein AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG Non-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGTAAGACCATACA Gl...

Ngày tải lên: 18/02/2014, 16:20

11 571 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... aggregate associated with collagen in fish otoliths Hidekazu Tohse 1,2 , Yasuaki Takagi 2 and Hiromichi Nagasawa 1 1 Department of Applied Biological Chemistry, Graduate School of Agricultural and Life ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metastable arago...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... sequence tag mining and functional expression assay Masaaki Shibuya 1 , Masaki Hoshino 1 , Yuji Katsube 1 , Hiroaki Hayashi 2 , Tetsuo Kushiro 1 , and Yutaka Ebizuka 1 1 Graduate School of Pharmaceutical ... derivatives. Bioorg Med Chem Lett 7, 85–88. 51 Banno N, Akihisa T, Tokuda H, Yasukawa K, Higashi- hara H, Ukiya M, Watanabe K, Kimura Y, Hasegawa J & Nishino H (2004) Triterpene...

Ngày tải lên: 19/02/2014, 07:20

12 705 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... in rat ovary and placenta. Cell Tissue Res 320, 525–533. 45 Banan A, Zhang LJ, Shaikh M, Fields JZ, Choudhary S, Forsyth CB, Farhadi A & Keshaarzian A (2005) Theta isoform of protein kinase ... Stratagene, La Jolla, CA, USA) and the Online Predicted Human Interaction Data- base (OPHID; http://ophid.utoronto.ca). OPHID is a web- based database of about 40 000 predicted and known...

Ngày tải lên: 19/02/2014, 07:20

13 460 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢; and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAG UUCUG-AG-3¢. The forward sequence of the scrambled RNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAG AG-3¢. OVISE cells were plated ... assay. The main fraction contained a 75 kDa matriptase as a major component and a few contamin- ating proteins as analyzed by SDS ⁄ PAGE. RNAi experiments with OVISE cells Matriptase...

Ngày tải lên: 19/02/2014, 07:20

13 603 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... sequences yef1-attB1FSD AAAAAGCAGGCTCC GAAGGAGATATAAAA ATGAAAACTGATAGATTACTG yef1-attB2R AGAAAGCTGGGTG GATTGCAAAATGAGCCTGAC attB1 ACAAGTTTGTACAAAAAAGCAGGCT attB2 ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGC...

Ngày tải lên: 20/02/2014, 01:20

13 560 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... DMEM. The medium was removed 24 h after the start of transfec- tion, the monolayer rinsed twice with OptiMem, and then 5 mL of was added to each flask. This was incubated for a further 16 h before harvesting ... kinetic analysis of the ACE2 mutants was not feasible. These data establish an important role for both His505 and His345 as their replacement results in enzyme activity b...

Ngày tải lên: 20/02/2014, 01:20

9 789 2
w