Báo cáo khoa học: Sequence variants of chicken linker histone H1 a pot
Báo cáo khoa học: Sequence variants of chicken linker histone H1.a pot
... histone H1. a E. Go ´ rnicka-Michalska et al. 1250 FEBS Journal 273 (2006) 1240–1250 ª 2006 FEBS Sequence variants of chicken linker histone H1. a Ewa Go ´ rnicka-Michalska 1 , Jan Pałyga 1 , Andrzej ... his- tone H1. y preparation was sequenced as a mixture of the histone H1. y and an accompanying histone H1. a2 . Thus, the automated Edman degradation of H1...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Catalytic digestion of human tumor necrosis factor-a by antibody heavy chain pot
... cleaved peptide bonds are indicated by arrows. Cleavage at Gln21-Ala22 gave a band at 15 kDa in SDS ⁄ PAGE. Cleavages at Leu36-Leu37 and Asn40-Gly41 gave a band at 13 kDa. The cleaved Gln21-Ala22 ... many natural catalytic antibodies. The first natural catalytic anti- body isolated from the serum of an asthma patient was reported by Paul et al. [1]. The catalytic antibody could enzymatic...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Secondary structure of lipidated Ras bound to a lipid bilayer pptx
... of Ras at the air–water interface was analysed. With the largely increased signal-to-noise ratio of ATR-FTIR, we have, for the Table 1. X-Ray and NMR-based secondary structure of Ras in comparison ... filtra- tion, using AmiconÒ concentrators. All protein batches were analysed by SDS-PAGE and MALDI-TOF-MS. Preparation of the ATR crystal The germanium IRE of the ATR was cleaned chemic...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... University of Melbourne, Australia 2 The Mental Health Research Institute of Victoria, Parkville, Australia 3 Department of Psychiatry, Massachusetts General Hospital, Charlestown, MA, USA Introduction Alzheimer’s ... and Fe, considerable data indi- cates a loss of Zn homeostasis in AD. Abnormally high concentrations of Zn are associated with amyloid plaques in AD brain [17,37,38]...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khóa học: Functional characterization of the evolutionarily divergent fern plastocyanin potx
... Yoshizaki, F., Sasakawa, Y., Onodera, K., Nagatomo, S., Kitagawa, T., Uzawa, S., Isobe, Y., Sugimura, Y., Gotowda, M. & Kai, Y. (1999) The structure and unusual pH dependence of p lastocyanin ... M .A. , Navarro, J .A. , Dı ´ az-Quintana, A. , De la Cerda, B., Molina-Heredia, F.P., Balm e, A. , Murd och, P.S., Dı ´ az- Moreno, I., Dura ´ n, R.V. & H erva ´ s, M. (2002) An evolutio...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: "Unsupervised Learning of Dependency Structure for Language Modeling" potx
... requires a large annotated training corpus and a decoder that assigns linguistic structure, which are not always available. This paper presents a new dependency language model (DLM) that captures ... the probability of training data is less than a threshold. Initialize: We set a window of size N and assumed that each headword pair within a headword N-gram constitutes a...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo khoa học: "Dependency Parsing of Hungarian: Baseline Results and Challenges" potx
... Daisuke Kawahara, Maria Ant ` onia Mart ´ ı, Llu ´ ıs M ` arquez, Adam Meyers, Joakim Nivre, Sebastian Pad ´ o, Jan ˇ St ˇ ep ´ anek, Pavel Stra ˇ n ´ ak, Mihai Surdeanu, Nianwen Xue, and Yi Zhang. ... lexical database and morpho- logical grammar. In Proceedings of 5th Inter- national Conference on Language Resources and Evaluation (LREC ’06). D ´ aniel Varga, P ´ eter Hal ´ acsy, Andr ´ as...
Ngày tải lên: 17/03/2014, 22:20
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately ... inevitable partial degradation of nucleolin, mean that calculations of binding affinity are unrealistic at this stage. Nucleolin localization in muscle is analogous to PTPr ligand locali...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx
... cerevisiae strain GIL77 Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAG GTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCA AAGGAACTCTTCT-3¢), corresponding to the N- and C-terminal sequences of b-amyrin synthase from ... Yuji Katsube 1 , Hiroaki Hayashi 2 , Tetsuo Kushiro 1 , and Yutaka Ebizuka 1 1 Graduate School of Pharmaceutical Sciences, The University of Tokyo, Japan 2 Gifu Pharmaceutical University...
Ngày tải lên: 19/02/2014, 07:20