Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
... on the right, and a view of the Worker’s work area in the left hand panel. The advantage of this setup is that it allows exploration of a number of different arrangements of the shared visual ... data analysis, as well as our qualitative examina- tion of the data, that the pairs make tradeoffs be- tween relying on the linguistic context and the visual c...
Ngày tải lên: 24/03/2014, 03:20
Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx
... diacylglycerols of sea urchin. Trans- plantation 74, 261–267. 3 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk- age A, Yoshida S & Sakaguchi K (1998) ... alga, Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684– 686. 5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw- ara F, Matsukage A, Yoshida S & Sakaguchi K (1999) Action of a...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
... for Japanese, and hyphens indicate char- acter boundaries. Different types of charac- ters are used in Japanese: hiragana, katakana, kanji, symbols, numbers, and letters of the Ro- man alphabet. ... member of the candidate for the definition of . According to this ordering, two candidates can have the same rank. One of them might assert that a certain word is an organizatio...
Ngày tải lên: 08/03/2014, 05:20
Báo cáo khoa học: AdipoR2 is transcriptionally regulated by ER stress-inducible ATF3 in HepG2 human hepatocyte cells pdf
... atf3-sense, 5¢-GGTTTGCCATCCAGAACAAG-3¢; atf3-antisense, 5¢-CC TCCCAGGAGAAGGTAAGC-3¢; adipor2-sense, 5¢-TAGC CTTTGGTTTGCTTTGG-3¢; adipor2-antisense, 5 ¢-CATAT CTCCAGGCGTCAACC-3¢; gapdh-sense, 5¢-ATGACATC AAGAAGGTGGTG-3¢; ... 5¢-GAGATTGCACCACTGC GCTCTA-3¢, reverse 5¢-AGCCAGAATGTCCCGTCAA AAA-3¢) as a negative control. Statistical analysis All values for the luciferase activity assay are mean...
Ngày tải lên: 22/03/2014, 21:21
Báo cáo khoa học: "An efficient algorithm for building a distributional thesaurus (and other Sketch Engine developments)" pdf
... (Kilgarriff et al., 2004). Another innovative development in the same tool is the presentation of the grammatical behaviour of a word against the background of how all other words of the same ... data, a variant of TPMMS (Two Phase Multi-way Merge Sort) is used. First we fill the whole available memory with a part of the data, sort in memory (summing where we...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
... al. 1176 FEBS Journal 273 (2006) 1166–1176 ª 2006 The Authors Journal compilation ª 2006 FEBS Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease Montserrat ... for the putative mechanism of domain-swapping dimerization of RNase A and the human pancreatic ribonuclease variant, PM8....
Ngày tải lên: 16/03/2014, 13:20
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx
... (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate amplification of the target amplicon was checked by obtaining ... sequencing chemistry. Real-time quantitative PCR Quantitative RT-PCR analysis was performed using the iCycler apparatus (Bio-Rad, Hercules, CA, USA). Total RNA...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39–46. 34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y & Kishi ... the molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients with AMI and to validate the use of serum DNase...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... novel interactor of the C-ter- minus of Arabidopsis thaliana plasma membrane H + -ATPase (EC 3.6.3.6) (Morandini P, Valera M, Albumi C, Bonza MC, Giacometti S, Ravera G, Murgia I, Soav...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
... 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH ... min, the absorbance of the supernatant was read at 363 nm. The absorbance of the reduced form of APAD (APADH) was linear over the 2–100 l M range of glutamate with a molar...
Ngày tải lên: 19/02/2014, 12:20