Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

... 5¢-GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGCTCATG-3¢(sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTC-3¢ (antisense), and ligated into ... localization of MPP3, a novelmember of the MPP5 protein scaffold at the outer limiting membrane (OLM), and of the DLG1 protein scaffold at the outer plexiform layer of the retina. MPP3 localized at ... photoreceptors andMu¨ller glia cells. Based on the recruitment of MPP3 to the MPP5 protein scaffold at the OLM, the involvementof MPP5 in the CRB1 protein scaffold, the disruptionof retinal...

Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

... entities. In other words, the sub-tree is enclosed by the shortest path linking the two entities in the parse tree (this path is also commonly-used as the path tree fea-ture in the feature-based ... trees. Their tree kernels require the match-able nodes to be at the same layer counting from the root and to have an identical path of ascend-ing nodes from the roots to the current nodes. The ... maintain the tree structure information. In addition, their ker-nel requires the two paths to have the same length. Such constraint is too strict. 5.2 Other Issues (1) Speed Issue: The recursively-defined...

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity doc

... subtilis enzyme,although this part of a-helix E is distorted and the histidine points to the exterior of the proteins,towards the solvent.All these previous observations suggest that the active ... conservation of the residuesknown until now to be involved in the catalyticmechanism, another signiﬁcant difference is presentin the H. pylori enzyme. In the latter enzyme, His86,which belongs to ... nucleophile, is shown in red, and His 86 is shownin orange. It is possible to see how the latter residue points into the active site in the former and in the opposite direction in the latter. (B)Stereo...

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

... located at the 5¢ untranslated region of the PABP-mRNA. In this report, we have further characterized the interactionbetween PABP and IMP1 with the ARS at the molecular level. The dissoci-ation ... ribonucleoprotein complex at the ARS of PABP mRNA.AbbreviationsARC, autoregulatory ribonucleoprotein complex; ARS, autoregulatory sequence; IMP1, insulin-like growth factor II mRNA binding protein- 1KH, ... hetrodimerizationbetween PABP and IMP1. Taken together, theseresults indicate that IMP1 and PABP may form a plat-form for the formation of a large ARC on the ARSthrough further protein protein...

Báo cáo khoa học: On peptide bond formation, translocation, nascent protein progression and the regulatory properties of ribosomes ppt

... consistentwith the universal nature of the tRNA A- to P-site passage.This requirement is somewhat released when the participa-tion of the phosphate, rather than the base is required, as is the ... forms a scaffold that guides the motion from the A- to the P-site(Fig. 3). This guidance, together with the front-side anchor-ing, provides the precise path for the rotating moiety. Mostof the ... nucleotides,guide the rotating moiety and provide the precise path thatleads to an orientation suitable for peptide bond formation. The spiral rotation ensures the entrance of the nascentproteins into their...

Báo cáo khoa học: Irregular dimerization of guanylate cyclase-activating protein 1 mutants causes loss of target activation ppt

... aremyristoylated at the N-terminus, but they do not undergo aCa2+–myristoyl switch as do other NCS proteins such asrecoverin and hippocalcin [10,11]. However, they changetheir conformation ... excessCa2+in the protein sample over that present in the ultraﬁltrate. The data were analysed as follows:½Ca2þfree¼ðRf=RpÞÂ½Ca2þtotalwhere Rf is the radioactivity in the ﬁltrate, Rp is ... GCAP; guanylate cyclase; neuronal Ca2+sensor;phototransduction.Light triggers the activation of a G -protein coupled cascadein photoreceptor cells that ultimately leads to the hydrolysisof 3¢,5¢-cyclic...

Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot

... requirement to ensure that the effective dissociation constantsmatch the protein concentrations in vivo.One can speculate on the hypothetical advantagesof a regulation mechanism based on the equilibriumbetween ... sug-gests that the conserved feature is, indeed, the forma-tion of a dimer, and rules out the alternativeexplanation that dimer formation is a necessary side-effect of the conservation of the active ... vitro. Struc-tural data suggest that substrate modulation of the oligomerization equilib-rium could be a regulatory mechanism leading to the generation ofsignaling pulses. The presence of a phenylalanine...

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-speciﬁc manner ppt

... DATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCTATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCTATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCTATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCTATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCTATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCTATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCTMut ... MYB1ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCTMut AATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCTMut BMut CMut DATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCTATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCTATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCTATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCTATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCTATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCTATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCTMut ... that the depletion of LIN9in human cells inhibits proliferation and results indelayed entry into mitosis [9]. To address whether this is an isolated function of LIN9 or whether it is medi-ated...

Báo cáo khóa học: Fidelity of targeting to chloroplasts is not affected by removal of the phosphorylation site from the transit peptide doc

... by the fact that they are able to targetpassenger proteins to the appropriate organelle. The receptor machinery on the outer membranes of chloroplastsand mitochondria is able to discriminate ... inwhich isolated mitochondria and chloroplasts from pea aremixed together and incubated with the precursor proteins,and then the organelles are re-separated. The authors reportthat this allowed them ... From these experiments we canconclude that the presence of the GFP as passenger protein, rather than the mature SSU protein, did not affect the ability of the SSU transit peptide to target proteins...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... synthesis [15,16]. It follows that, unless thereare other unrecognized d1biogenesis proteins,then NirF must catalyse the last step(s) in d1hemesynthesis. The nature of these synthesis ... the resulting d1heme then being translocated to the periplasm. In the case of P. pantotrophus it would be the substrate forNirF that is translocated. In either case the transportprocess is ... chain satu-rated, but accessing these putative substrates is nottrivial. An alternative approach would be to seek accu-mulation of the substrate of NirF in a mutant thatlacks NirF; this too is...

Xem thêm