Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
... 11444–11455.
12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K,
Takahashi M & Nakagawara A (2003) Function of p73,
D. O. Passos et al. Functional association of Ki-1 ⁄ 57 and PRMT1
FEBS Journal 273 (2006) ... The Authors Journal compilation ª 2006 FEBS 3961
Ki-1
⁄
57 interacts with PRMT1 and is a substrate for
arginine methylation
Dario O. Passos
1,2
, Gustavo C....
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... derlined),
87SufI-BamHI-rv (5 ¢-ACGC
GGATCCAACATCGTCGC
CCTTCCA-3¢, BamHI site underlined) and SufIHA-
XbaI+ClaI-rv (5¢-ACTG
ATCGATCTAGATTACGCAT
AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG
GTACCGGATTGACCAAC- 3¢, ClaI site ... (5¢-GCGCG
GAGCTCAAGAAGGA
AGAAAAATAATGAAC-3¢, SacI site underlined) and
TorA/Lep2-BamHI-rv (5¢-GCAT
GGATCCCGCGCGC
TTGATGTAATC-3¢, BamHI site underlined). The result-
ing PCR fra...
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
... b-d-galactopyranoside
(Gal-ONp) as a substrate for b-galactosidase (Fig. 6C).
Screening variants for 3-amino-1,2,4-triazole resistance
and a lacZ-positive phenotype revealed that C-terminal
truncation ... USA
Accurate aminoacylation of tRNA by aminoacyl-tRNA
synthetases (aaRSs) is a crucial step in the faithful
translation of mRNA. In addition to their fundamental
role in tran...
Báo cáo khoa học: "Learning to Translate with Source and Target Syntax" pot
... Liang Huang, Kevin Knight, and Aravind Joshi. 2006.
Statistical syntax-directed translation with extended
domain of locality. In Proc. AMTA 2006, pages
65–73.
Alon Lavie, Alok Parlikar, and Vamshi ... ACL-08: HLT, pages 559–567.
Andreas Zollmann and Ashish Venugopal. 2006. Syn-
tax augmented machine translation via chart parsing.
In Proc. Workshop on Statistical Machine Transla-
tion,...
Báo cáo khoa học: "Reducing semantic drift with bagging and distributional similarity" pdf
... pre-processing and can be
applied to raw text, and are efficient enough for
tera-scale extraction (Pas¸ca et al., 2006).
Bootstrapping is minimally supervised, as it is
initialised with a small number ... affects
humans, animals and or plants
asthma hepatitis tuberculosis HIV malaria
(κ
1
:0.98, κ
2
:1.0)
DRUG
Drugs: A pharmaceutical preparation
acetylcholine carbachol hepari...
Báo cáo khoa học: "Tagging Urdu Text with Parts of Speech: A Tagger Comparison" doc
... probability of a word having a par-
ticular tag is called lexical probability. Both, the
transitional and the lexical probabilities are used
to select the tag of a particular word.
As a standard ... Adjec-
tival particle (A) , KER (KER), SE (SE) and
WALA (WALA) are ambiguous entities which
are annotated with separate tags. A complete list
of the tags with the example...
Báo cáo khoa học: Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1 doc
... Fukuhara S, Sakurai A, Yamagishi A, Kami-
oka Y, Nakaoka Y, Masuda M & Mochizuki N (2005)
Local activation of Rap1 contributes to directional vascu-
lar endothelial cell migration accompanied ... Rap1GTP to sites of cell
spreading and serve as exchange factors for Rac [6].
ARAP3 is a GTPase-activating protein for RhoA and
Arf6 that affects PDGF-induced lamellipodia forma-
ti...
Báo cáo khoa học: "Statistical Machine Translation with Word- and Sentence-Aligned Parallel Corpora" potx
... parallel
corpus as a source of training data because it has
been used extensively in evaluating statistical trans-
lation and alignment accuracy. This data set comes
with a manually word-aligned set ... 13.55 0.128
Table 6: Summary results for AER and translation
quality experiments on Hansards data
guage), the Hansards has ten times that many vocab-
ulary items and has a much...
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver
stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately ... ligands of the RPTPs in
the neuromuscular system. For example, it is known
that PTPd and an isoform of LAR can interact
homophilically [39] and that LAR can also bind
heterophilical...
Báo cáo khoa học: The enantioselectivities of the active and allosteric sites of mammalian ribonucleotide reductase pptx
... a- site binding, whereas ATP is a universal
activator because it induces R1
6
formation as a
result of h-site binding.
RR is a well-recognized target for cancer chemo-
therapeutic and antiviral ... phase activation of CDP reductase,
leading to the conclusion that l-ATP, like dATP,
L-ATP
dATP
ATP
dGTP
dTTP
L-ATP
dATP
ATP
Scheme 1. Allosteric ligand effects on enzyme aggregation...
Từ khóa: