Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
... 11444–11455. 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi M & Nakagawara A (2003) Function of p73, D. O. Passos et al. Functional association of Ki-1 ⁄ 57 and PRMT1 FEBS Journal 273 (2006) ... The Authors Journal compilation ª 2006 FEBS 3961 Ki-1 ⁄ 57 interacts with PRMT1 and is a substrate for arginine methylation Dario O. Passos 1,2 , Gustavo C....
Ngày tải lên: 16/03/2014, 13:20
... derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC- 3¢, ClaI site ... (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). The result- ing PCR fra...
Ngày tải lên: 07/03/2014, 16:20
... b-d-galactopyranoside (Gal-ONp) as a substrate for b-galactosidase (Fig. 6C). Screening variants for 3-amino-1,2,4-triazole resistance and a lacZ-positive phenotype revealed that C-terminal truncation ... USA Accurate aminoacylation of tRNA by aminoacyl-tRNA synthetases (aaRSs) is a crucial step in the faithful translation of mRNA. In addition to their fundamental role in tran...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: "Learning to Translate with Source and Target Syntax" pot
... Liang Huang, Kevin Knight, and Aravind Joshi. 2006. Statistical syntax-directed translation with extended domain of locality. In Proc. AMTA 2006, pages 65–73. Alon Lavie, Alok Parlikar, and Vamshi ... ACL-08: HLT, pages 559–567. Andreas Zollmann and Ashish Venugopal. 2006. Syn- tax augmented machine translation via chart parsing. In Proc. Workshop on Statistical Machine Transla- tion,...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: "Reducing semantic drift with bagging and distributional similarity" pdf
... pre-processing and can be applied to raw text, and are efficient enough for tera-scale extraction (Pas¸ca et al., 2006). Bootstrapping is minimally supervised, as it is initialised with a small number ... affects humans, animals and or plants asthma hepatitis tuberculosis HIV malaria (κ 1 :0.98, κ 2 :1.0) DRUG Drugs: A pharmaceutical preparation acetylcholine carbachol hepari...
Ngày tải lên: 08/03/2014, 00:20
Báo cáo khoa học: "Tagging Urdu Text with Parts of Speech: A Tagger Comparison" doc
... probability of a word having a par- ticular tag is called lexical probability. Both, the transitional and the lexical probabilities are used to select the tag of a particular word. As a standard ... Adjec- tival particle (A) , KER (KER), SE (SE) and WALA (WALA) are ambiguous entities which are annotated with separate tags. A complete list of the tags with the example...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1 doc
... Fukuhara S, Sakurai A, Yamagishi A, Kami- oka Y, Nakaoka Y, Masuda M & Mochizuki N (2005) Local activation of Rap1 contributes to directional vascu- lar endothelial cell migration accompanied ... Rap1GTP to sites of cell spreading and serve as exchange factors for Rac [6]. ARAP3 is a GTPase-activating protein for RhoA and Arf6 that affects PDGF-induced lamellipodia forma- ti...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: "Statistical Machine Translation with Word- and Sentence-Aligned Parallel Corpora" potx
... parallel corpus as a source of training data because it has been used extensively in evaluating statistical trans- lation and alignment accuracy. This data set comes with a manually word-aligned set ... 13.55 0.128 Table 6: Summary results for AER and translation quality experiments on Hansards data guage), the Hansards has ten times that many vocab- ulary items and has a much...
Ngày tải lên: 31/03/2014, 03:20
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately ... ligands of the RPTPs in the neuromuscular system. For example, it is known that PTPd and an isoform of LAR can interact homophilically [39] and that LAR can also bind heterophilical...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: The enantioselectivities of the active and allosteric sites of mammalian ribonucleotide reductase pptx
... a- site binding, whereas ATP is a universal activator because it induces R1 6 formation as a result of h-site binding. RR is a well-recognized target for cancer chemo- therapeutic and antiviral ... phase activation of CDP reductase, leading to the conclusion that l-ATP, like dATP, L-ATP dATP ATP dGTP dTTP L-ATP dATP ATP Scheme 1. Allosteric ligand effects on enzyme aggregation...
Ngày tải lên: 07/03/2014, 17:20