Báo cáo khoa học: The propeptide of cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F ppt
Báo cáo khoa học: The propeptide of cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F ppt
... cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F 5Flavia C. G. Reis1, Tatiana F. R. Costa1, Traian Sulea2, Alessandra ... prodo-main of cruzipain, the similarity of the mature domain of cathepsin F to that of cruzipain is higher (48 %) than that between the mature domains of cruzipain and cathepsin W (32 %). In order ... candidate as a lead for the design of potent peptidyl inhibitors aimed at the inacti-vation of CPs from several pathogenic protozoa. The propeptide of cruzipain is a potent inhibitor of cathepsin F To...
- 11
- 385
- 0
Tài liệu Báo cáo khoa học: "STRING-TREE CORRESPONDENCE GRAMMAR: A DECLARATIVE GRAMMAR FORMALISM FOR DEFINING THE CORRESPONDENCE BETWEEN STRINGS OF TERMS AND TREE STRUCTURES" pdf
... SAINT-MARTIN-D'HERES FRANCE ABSTRACT The paper introduces a grammar formalism for defining the set of sentences in a language, a set of labeled trees (not the derivation trees of the ... the form of a labeled tree, and the relation between a string of terms and a structural representation is defined as a mapping between elements of the set of substrings of the string and elements ... one hand a set of strings of terms and on the other a set of structural representations - a structural representation being in a form amena- ble to processing (say for translation into another...
- 7
- 444
- 0
Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf
... empty) WordNet 3.0 synset offset;(d) the number of senses in all languages and their full listing; (e) the number of translation re-lations and their full listing; (f) the number of se-mantic ... words on the basis of the se-mantic connections found in the lexical knowledgebase, along the lines of Navigli and Lapata (201 0). At its core, the API leverages an in-house Java li-brary to ... research on the topic has explored the translation of sentencesinto many languages (Navigli and Ponzetto, 2010;Lefever et al., 2011; Banea and Mihalcea, 201 1), as well as the projection of monolingual...
- 6
- 400
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... syntactic parser. In Figure 2 we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... Sciences and Humanities Research Council of Canada. [1] Reduplication is a word formation process involving the repetition of a word or a part of a word. As an example, in Warlpiri there is a process...
- 8
- 522
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... rep-resents the first example of the effects of an antimicro-bial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial mem-branes are the major targets of its mechanism ... in the combination, MIC A and MICBare the MICs of drug A and drug B alone, FIC A and FICBare the FICs of drug A and drug B and n is the number of wells per plate used toL. Marcellini et al. ... differenttime intervals, and b-lactamase activity was detected as describedabove and expressed as percentage of the total obtained after celllysis. Data are the means ± standard deviations of three indepen-dent...
- 18
- 494
- 0
Báo cáo khoa học: Metal exchange in metallothioneins – a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a ppt
... spec-troscopy. Following addition of the final aliquot of 113CdCl2, the NMR sample was argon-saturated and sealed for analysis. All of the NMR spectra wereacquired on a Varian Inova 600 NMR spectrometerusing ... spectrometer funded by the CanadaResearch Chair program, Doug Hairsine (WesternOntario) for advice and discussion on operation of the ESI mass spectrometer, and ACD Labs for anacademic trial license for ... toaddition of 5.0 molar equivalents of Cd2+. The Cd2+wasadded as the sulfate salt dissolved in 25 mm ammoniumformate buffer (pH 7. 4) to a final concentration of 3.3 mm. Mass spectra were acquired...
- 13
- 438
- 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf
... Binding affinity of the ARS RNA to PABP and IMP1 (A) and (B) Gel-shift assays of binding of PABP and IMP1 to the ARS RNA.Uniformly radiolabelled ARS RNA was incubated with an increasingamount of purified ... pDU-RBDIV(s) EarI-catggaacagatgaaacaa10 pDU-PABPC(s) EarI-catggagcgccaggctcac11 pDU-IMP1(s) EarI-catgaacaagctttacatcg12 pDU-KH1(s) EarI-catggtggacatcccccttcgg13 pDU-KH3(s) EarI-catggctgctccctatagctcc14 ... have found that both polypeptides bindstrongly to a 22 nucleotide long CCCAAAAAAAUUUACAAAAAA sequence located at the 3¢ end of the ARS. Furthermore, CCCAAAAAAAUUU wasfound to be the minimal...
- 13
- 466
- 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
... be successful in the analysis of the dialect vari-ation, all of them aggregate over the entire availabledata, failing to extract linguistic structure from the aggregate analysis. Two attempts ... aggregateanalysis of pronunciation differences for Bulgarianwas done on the data set that comprised 36 wordpronunciations from 490 sites. The data was digital-ized from the four-volume set of Atlases of Bulgar-ian ... variations and has been done for differentlanguages. For several languages aggregate analyseshave been successfully developed which distinguishvarious dialect areas within the language area. The 61most...
- 6
- 651
- 0
Báo cáo khoa học: "Age Prediction in Blogs: A Study of Style, Content, and Online Behavior in Pre- and Post-Social Media Generations" ppt
... (13-1 7) 48.2% (22-3 2) Table 4: Statistics for Schler et al.’s data (blog-ger.com) vs our data (livejournal.com)1is approxi-mate amount. the averages of the accuracies from the 10 cross-validation ... et al., 200 2). Goswami etal. (200 9) add to Schler et al.’s approach using the same data and have a 4% increase in accu-racy. However, the paper is lacking details and it is entirely unclear ... features such as collocations and part -of- speech collocations, lexical-stylistic fea-tures such as internet slang and capitalization, and features representing online behavior suchas time of...
- 10
- 540
- 1
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ