Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data is gratefully acknowl- edged. ... metal-binding recognition as well as reactivity in chemical transformations. Func- tional annotation of cupin proteins from sequence and 3D structural data a...
Ngày tải lên: 18/02/2014, 06:20
Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt
... are parasitic protozoa belonging to the order Kinetoplast- ida. They are causative agents of several highly disab- ling and often fatal diseases, including African sleeping sickness, Chagas disease ... branch that D5 desaturases in nem- atodes and vertebrates may have diverged from an ancestral D6 desaturase in each of these lineages after gene duplication. L. major D6 desaturase...
Ngày tải lên: 07/03/2014, 12:20
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... (5¢-TAATACGACTCACTATAGGGGA ATTG-3¢) and reverse primer Int R (5¢-CCCATGACCT TATTACCAACCTC-3¢), respectively. The final amplified fragment was digested with XbaI and KpnI and inserted into pAB146. ... was inserted as alinker (Figs 1 and 2). Chromosomal DNA from E. coli strain UY211 (ara, D(lac-pro), nalA, thi) [32] was isolated and used as a template in two separate PCR reactions t...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Solution structure of crotamine, a Na+ channel affecting toxin from Crotalus durissus terrificus venom docx
... batrachotoxin and grayanotoxin [8]. Indeed, recent studies on the inactivation kinetics of the Na + current [11] have evidenced that Crt and scorpion a- toxins act in a very similar fashion. Based ... Catterall, W .A. (1996) Molecular determinants of high a nity binding of a- scor- pion toxin and sea anemone toxin in the S3–S4 extracellular loop in domain IV of the N...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf
... FLAG-tagged D 2 receptors, using, in this case, the following oliogo- nucleotide encoding the FLAG epitope sequence: 5¢-GCGGCCGCATGGACTACAAGGACGACGATGA CAAGGATCCACTGAATCTGTCCTGG-3¢.This sequence contains, in addition ... plasmid instead of TOPO, and Baculogold TM DNA (Pharmingen) instead of Bac-N-Blue TM DNA. All the viruses were purified using plaque assay purification and amplified...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAA...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx
... and 300 nM (d). Observed rate constants (k obs ) were obtained from these plots and are the average of two independent assays. All data points between the two independent assays have a standard ... USA). Data were fit using the kaleidagraph curve-fitting program (Synergy Software, Reading, PA, USA). The final concentration of the radiolabeled substrate in all reactions is 1.3 nm. A...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢ Sequence verification Plasmids of the ... :5¢-CTT CTTGGGATCTTT CCACATCAGCTCCAGCAG-3¢. Q81N- fwd:5¢-TGGGCCATGCCCTTT AACAGTTATGTCACG CTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACT GTTAAA GGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAA TGGAGC A...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The spectral ... initiates the reaction, as revealed by gradual diminution of the Soret band. After several minutes, a broad band appears at around 660–675 nm; this increases in inten- sity with...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt
... DASA polar are the changes in ASA of the apolar and polar residues, respectively [39]. The structure-based calculations provide a DC p of )407 calÆmol )1 ÆK )1 and DASA apolar and DASA polar of )1354 and ... This approach is clearly an approximation; according to this parameterization, the changes in heat capacity arise from binding- induced changes in the solvent polar...
Ngày tải lên: 19/02/2014, 05:20