Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
... fatty acids and Table 1. Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands. Whole inguinal mammary fat pads were isolated and contents of fatty ... FEBS Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3...
Ngày tải lên: 16/03/2014, 10:20
... 5¢-GACCTGCTTCCCGATGACTTT-3¢ and antisense, 5¢-TTCCTCCAACCACAGCACATAC-3¢); UBC9 (sense, 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ and antisense, 5¢-GCATCCGTAGCTTGAACAAGCCTC-3¢); PIAS3 (sense, 5¢-ACTGCAGGGACCCTGCTACA-3¢ and antisense, ... 5¢-GAGAATCCAGCTTCTTTCCC-3¢ and antisense, 5¢-GGCGACACTGTATGAATTGC-3¢); SENP2 (sense, 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢);...
Ngày tải lên: 23/03/2014, 06:20
... 145 , 54–59. 24 Osheroff PL & Ho WH (1993) Expression of relaxin mRNA and relaxin receptors in postnatal and adult rat brains and hearts. Localization and developmental pat- terns. J Biol Chem ... Metab 292, E913–E919. 34 Hida T, Takahashi E, Shikata K, Hirohashi T, Sawai T, Seiki T, Tanaka H, Kawai T, Ito O, Arai T et al. (2006) Chronic intracerebroventricular administration o...
Ngày tải lên: 29/03/2014, 21:20
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... precisely, an Fig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla- tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDS–PAGE. At each time point, a 12 lL aliquot of the reaction ... relative degree of exposure was probed using a low-molecular-weight reagent Table 1. Kinetic constants for hydrolysis of S-2288 and activation of FX by...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt
... (PTMA) on activation of WT and mutant receptors were also investigated. PTMA is a poor partial agonist of the WT nAChR and it elicits a maximum current of only 1.5 ± 0.1% of the ACh response (data ... that subtype. Similar data show a lack of significant effect of dTC on the aR55W and R55E mutant recep- tors (data not shown). Table 2. Effects of PTMA and dTC on WT...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... M 2 -myc-EcoRI-s, 5¢-CAGAATTCatg gagcagaagctgatctccgagga ggacctg ctg GTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢. (An engineered EcoRI recognition ... cDNA was amplified by RT-PCR using total RNA separated from mix stage of C. elegans as a template with the following primers: M2-goa1-s, 5¢- CATTATAAGA ACATAGGCGCTACAA...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Activation, regulation, and inhibition of DYRK1A Walter Becker1 and Wolfgang Sippl2 pptx
... caapi and the mideastern shrub Peganum harmala (Syrian rue). Banisteriopsis is a component of hoasca (also called ayahuasca or yage ´ ), an hallucino- genic brew of plant extracts used in shamanic ... phosphorylation and activation of ERK8. Biochem J 394, 365–373. 86 Chang L & Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410, 37–40. Activation, regulation...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... constructed by PCR amplification of the Hsp9 0a ORF using the forward primer AAATAA GTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse pri...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... amplifying the hTRa1 cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢.In order to overexpress 4-1BB and TRAF1 in the HeLaTR cel...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx
... PAK1 activity was accessed with MBP as a substrate after immunoprecipitation with an antibody raised against PAK1. Activation of PAK1 by LPA was maximalat5minincubationwith7.8-foldincrease ,and returned ... immunocomplex MBP in-gel kinase assay, as described under Materials and methods, and MBP phosphorylation was analyzed by autoradiography. Data are presented as mean values w...
Ngày tải lên: 30/03/2014, 13:20