Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B, Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis. ... Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that cause important h...

Ngày tải lên: 16/03/2014, 10:20

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ....

Ngày tải lên: 08/03/2014, 10:20

... instead of FAD, or NADPH instead of NADH no NoxC activity was found For this reason, further purification and characterization of NoxC was abandoned. Purification of the recombinant enzymes NoxA-1 and ... [19]. The reaction was started upon addition of anoxic NADH. The decrease in oxygen concentration was calculated from the decrease in NADH, assuming that for each mole o...

Ngày tải lên: 08/03/2014, 02:21

... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relative abundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... methylation analysis, on the basis of the chemical shift data and the large J 2,3 , J 3,4 and J 4,5 values ( 9 Hz). On the basis of low J 3,4 and J 4,...

Ngày tải lên: 08/03/2014, 02:21

... intracellular and extracellular compartments [5]. Adeno sine kinase ( AK), which catalyzes the transfer of the c-phosphate from ATP to the 5¢-hydroxyl of Ado, generating AMP and ADP, is one of several enzymes ... National Institute of Drug Abuse (JAB), t he National Alliance forResearchonSchizophreniaandDepression(JAB),theNational Institute of Mental Health (ACN and RWG), t...

Ngày tải lên: 16/03/2014, 18:20

... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 (1) Protein containing DNAJ domain; unknown function cuacgucggacggaacugggaaaccgaucaguguugguagugaguuaa cucggugaccgaguuaguagaacgaguuaauuag UGUAAAUAcgaagcca At4g39090 ... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to A...

Ngày tải lên: 18/02/2014, 06:20

... LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... coordi- nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or an aspartate. The apparent conflict of this finding with the absence of...

Ngày tải lên: 18/02/2014, 06:20

... at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The ... estimated directly from the values of absorbance at these maxima (data not shown). The estimated association constants for imi- dazole and azide binding to heme–GmHO-1 are sum- ma...

Ngày tải lên: 19/02/2014, 05:20

... mutagenesis. Roles of Asn266 Superimposition of Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in the class A b-lactamase ... density map was poor for the C-terminal half of Ald [12]. In contrast, in Hyb-24D -A 112 –Ald and Hyb-24DNY- A 112 –Ald, the catalytic and binding residues and Ald in...

Ngày tải lên: 07/03/2014, 00:20

... Guimaraes da Costa F, Paschoal ME, Ronco LV, Carvalho MG & Pardee AB (1999) Identifi- cation of a gene encoding a human oxysterol-binding protein-homolog: a potential general molecular marker for ... enhanced chemiluminescence (Amersham Biosciences). Acknowledgements This work was supported by a Young Investigator Award from the National University of Singapore, a grant...

Ngày tải lên: 07/03/2014, 21:20