Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt

Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt

Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt

... Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study Alessandro Bolli 1 , Chiara Ciaccio 2,3 , Massimo Coletta 2,3 , Marco Nardini 4 , ... þ p ðð cyanide þK þ [trHb(II)]Þ 2  4  cyanide ½trHb(II)ÞÞ= ð2 ½trHb(II)Þ ð11Þ Data analysis Data analysis was performed with the program matlab 7.0 (Ma...

Ngày tải lên: 16/03/2014, 06:20

13 366 0
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf

Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf

... drugs against malaria that are available or under development target a single process of the parasite infective cycle, favouring the appearance of resistant mutants which are easily spread in areas ... aspartic protease catalytic class, was previously reported [12]. Accordingly, an additional inhibition assay was performed using P. falciparum protein extracts and including cathepsin D (a...

Ngày tải lên: 14/02/2014, 14:20

11 682 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... the present study for quantitative metal analysis (GF-AAS, ICP-MS) required adaptation by using l-tryptophan-con- taining standards to simulate the protein background. For example, in GF-AAS, high ... Tris(1,10- phenanthroline)lanthanum(III) Trithiocyanate (KP772). Curr Cancer Drug Targets 9, 59 5–6 07. 54 Allard P, Barra AL, Andersson KK, Schmidt PP, Atta M & Gra ¨ slund A (...

Ngày tải lên: 15/02/2014, 01:20

14 873 0
Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

... interac- A B 347150381203 442 BTBHTAMBPM1 189 1–1 51 F RAP2.4 1 150 214 AP2 334 60 12 5–2 51 C D BPM1 BPM1 1–1 51 BPM1 1–1 89 GST GST:RAP2.4 – – – – ++ + – – –+ – – + BPM1 T7 input BPM1 1–1 51 BPM1 1–1 89 –+ – +– – + –+ GST GST:BPM1 T7 input RAP2.4 1–2 51 RAP2.4 1–2 51 RAP2.4 1–2 95 RAP2.4 1–2 95 E RAP2.4 G179S RAP2.4 134–...

Ngày tải lên: 18/02/2014, 06:20

12 657 0
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

... Lysates were prepared at the indicated time points after the AG1478 addition and analyzed for caspase 3 activity by using a fluorometric substrate-based assay. Each point is the mean of triplicate ... activation of JNK. ERK1 and ERK2, also known as p4 4 and p4 2 MAPK, respectively, represent the prototypical MAPK in mammalian cells. ERK MAP kinase catalytic acti- vation was observed in P...

Ngày tải lên: 18/02/2014, 13:20

11 659 0
Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx

... genetically with ERG4 and NCP1. Fur- thermore, Erg 4p, Ncp 1p and Cbr 1p play important roles in cell polariza- tion during vegetative growth, mating and filamentation. As Ste2 0p and Cla 4p are involved ... the importance of sterols for cell polarization, and the interactions between PAKs and proteins catalyzing sterol synthesis and storage, it is tempting to speculate that Ste2 0p and...

Ngày tải lên: 18/02/2014, 13:20

12 699 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx

... ATPase. Nat Genet 38, 118 4–1 191. 34 Najim al-Din AS, Wriekat A, Mubaidin A, Dasouki M & Hiari M (1994) Pallido-pyramidal degeneration, supranuclear upgaze paresis and dementia: Kufor– Rakeb ... 26 9–2 81. 27 Tamura H, Takahashi T, Ban N, Torisu H, Ninomiya H, Takada G & Inagaki N (2006) Niemann–Pick type C disease: novel NPC1 mutations and characterization of the concomitant a...

Ngày tải lên: 18/02/2014, 14:20

7 652 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

... and polyclonal antibodies against IRb, polyclonal antibodies against EGF and polyclonal antibodies against Grb7 were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Monoclonal antibody against ... from Amersham-Phar- macia (Little Chalfont, UK) and Pierce Biotechnology Inc. (Rockford, IL, USA). WGA–Sepharose 6MB (WGA– Sepharose), protein G–Sepharose, protein A Sepharose and other chemic...

Ngày tải lên: 18/02/2014, 18:20

15 497 0
Tài liệu Báo cáo khoa học: His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases pptx

Tài liệu Báo cáo khoa học: His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases pptx

... Science and Technology, pp. 20 7–2 95. American Association of Cereal Chemists: St Paul, Minnesota, USA. 3 Coutinho PM & Henrissat B (1999) Carbohydrate- active enzymes: an integrated database approach. ... CCT AGATCTTTACAGGCCGCCGCAACCCGTAAAG XI019 CCGCAACCCGTAAAGGCCGGCAGCCTG XI022 CCGCAACCCGTAAACTTCGGCAGCCTG XI036 GCAGGCTGCCGCAATTTACGGG XI037 CCCGTAAATTGCGGCAGCCTGC K. Fierens et al....

Ngày tải lên: 19/02/2014, 07:20

11 523 0
w