Báo cáo khoa học: Purification and characterization of cathepsin B-like cysteine protease from cotyledons of daikon radish, Raphanus sativus docx

... & Kwon YM (2001) cDNA cloning of two isoforms of ornithine carbamoyltransferase from Canavalia lineata leaves and the effect of site-directed mutagenesis of the carbamoyl phosphate binding ... This paper reports the purification and characterization of GAT from wild watermelon leaves, and discusses its function during drought ⁄ strong-light stress on the basis of...

Ngày tải lên: 20/02/2014, 03:20

... sialidasetypeX ,protease enzymes and molecular mass standards were purchased from Sigma. Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii were collected from the local wetlands of ... Sarris and Palade [30] and Schauer [6]. A solution of 750 lL of glycoprotein (5 mgÆmL )1 ) was added to 250 lLof0.04 M of NaOH, vortexed, incubated on ice for 45 min...

Ngày tải lên: 21/02/2014, 00:20

... complex from A. fulgidus (Eur. J. Biochem. 269) 1899 absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome b. Heme was extracted from the ... FEBS Lett. 457 , 291–297. 1904 G. J. Mander et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing arc...

Ngày tải lên: 21/02/2014, 03:20

... min, bands with molecular masses of 43 and 39 kDa were observed in addition to undigested bands of ZP2 and ZP3. After incubation for 10 min, three major bands with molecu- lar masses of 43, 39 and ... to Professor F. S. Howell (Department of Materials and Life Sciences, Faculty of Science and Technology, Sophia University, Tokyo) for reading the manuscript and to Dr K. Y...

Ngày tải lên: 07/03/2014, 04:20

... Isolation and charac- terization of the cysteine- proteinases from the latex of Carica candamarcensis Hook. Biol Chem Hoppe-Seyler 374, 501–506. 18 Walraevens V, Vandermeers-Piret M, Vandermeers ... precursors and are activated in response to wounding of the plant [26]. Similar to other known cysteine proteinases from Car- icaceae, the deduced protein sequences of VXH-A, -B...

Ngày tải lên: 07/03/2014, 11:20

... Authors Journal compilation ª 2008 FEBS 5443 Purification and characterization of cathepsin B-like cysteine protease from cotyledons of daikon radish, Raphanus sativus Akihiko Tsuji, Yayoi Kikuchi, Kentaro ... BSA as a standard [40]. Purification of cathepsin B-like cysteine protease from daikon radish All purification procedures were performed at...

Ngày tải lên: 16/03/2014, 04:20

... Pro, Val or Lys, c-carboxylation of Glu, glycosylation of Ser or Thr, bromination of Trp, sulfation of Tyr, cyclization of N-terminal Gln, and epimerization of several different residues. It ... 1977 effect of the d-Phe on structure, was also studied. The unusual structure of conomarphin further demon- strates the high diversity of conotoxins. Results Purification and p...

Ngày tải lên: 18/02/2014, 17:20

... expression of T-bet has been seen within a wide variety of tissues and cells in the Ginbuna crucian carp [27] and, in mammals, in the lung tissue of mouse and spleen and thymus of human and mouse ... the expression of these genes within humans and mice, of T-bet within Ginbuna crucian carp [27] and STAT6 in mandarin fish [28] have shown similar widespread expression. I...

Ngày tải lên: 16/02/2014, 09:20

... properties of SmSmad1 and SmSmad1B as described above. However, in the presence of SmSmad4 and the active mutant form of TbRI, both SmSmad2 and SmSmad4 interacted with GCN5, indicating the formation of ... Drosophila MAD and the vertebrate Smad1, Fig. 1. Structure of the SmSmad1B gene, cDNA and protein. (A) Schematic representations of the SmSmad1B gene, cDNA and prote...

Ngày tải lên: 18/02/2014, 16:20

... Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai Ken-ichi Suzuki, Takao Ojima and Kiyoyoshi Nishita Laboratory of Biochemistry and Biotechnology, ... TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing sugars equivalent to 1.0 lmo...

Ngày tải lên: 20/02/2014, 23:20