Báo cáo khoa học: Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy pdf
Báo cáo khoa học: Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy pdf
... al. 4932 FEBS Journal 276 (2009) 492 1–4 932 ª 2009 The Authors Journal compilation ª 2009 FEBS Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy Elena ... constants of enzyme substrate (or protein–ligand) interactions from rapid reaction kinetic data. J Biol Chem 250, 404 8–4 052. 26 Fang J, Sawa T,...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf
... The rate of product formation was linear at least up to 120 s. The assay mixture contained 1 5–1 00 lml-Phe (as substrate for LAAO), 350 mU of horseradish peroxidase and 10 lm O-dianisidine (as substrate ... 25, 12 6–1 32. 39 Amersham Pharmacia Biotech (2001) Chromatofocusing with Polybuffer and PBE, pp. 1 5–2 4. Amersham Phar- macia Biotech AB, Uppsala. Inhibitor-binding site...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx
... GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG. The annealing site for the upstream primer corresponds to 12 amino acids before the protease sequence. ... (2.8 A ˚ ) and had van der Waals interaction with Cb of Ala28 (Ala128) at a distance of 3.9 A ˚ .Thesame arrangement has been observed for other C2-symmmertric diol-containin...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Interaction of gymnemic acid with cyclodextrins analyzed by isothermal titration calorimetry, NMR and dynamic light scattering doc
... heat (A) , and plotted against the molar ratio (GA ⁄ c-CD). The data were fitted using a nonlinear least-squares method. Table 1. Thermodynamic parameters of the interaction between GA and c-CD at ... The thermodynamic parameters at 25 °C are summarized in Table 1. Similar thermodynamic parameters at dif- ferent pH values between 4.5 and 9.5 indicate that the chemical structures of both...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Optimization of an Escherichia coli system for cell-free synthesis of selectively 15N-labelled proteins for rapid analysis by NMR spectroscopy pdf
... Saccharomyces carlsbergensis, no data available for E. coli; b value for Lupinus luteus and bovine, no data available for E. coli; c value for Paracoccus denitrificans, no data available for E. coli. d value ... coli. d value for Bacillus subtilis, no data available for E. coli; e no data available, assigned to group II based on side-chain rigidity; f no data available, assigned...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Mechanism of mild acid hydrolysis of galactan polysaccharides with highly ordered disaccharide repeats leading to a complete series of exclusively odd-numbered oligosaccharides doc
... 21 3–2 22. 27 Hama Y, Nakagawa H, Kurosawa M, Sumi T, Xia X & Yamaguchi K (1998) A gas chromatographic method for the sugar analysis of 3,6-anhydrogalactose-contain- ing algal galactans. Anal Biochem ... & Helbert W (2007) Degradation of lambda-carrageenan by Pseudoalteromonas carrageeno- vora lambda-carrageenase: a new family of glycoside hydrolases unrelated to kappa-...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Inhibition of aryl acid adenylation domains involved in bacterial siderophore synthesis ppt
... control was the development of the SAL-AMS compound for aryl acid A domain inhibi- tion of SAL-capped siderophore producing pathogens [8]. Inhibition of aryl acid A domains bears the advantage that ... precursor for both substrates. Both DHB and SAL containing siderophores represent virulence factors of important human pathogens (Fig. 1A) . Aryl substrate activation is c...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx
... antibacterial protein as a novel l-amino acid oxidase (LAAO; EC.1.4.3.2). LAAOs catalyze the oxidative deamination of an l-amino acid substrate and have been reported to exert antibacterial activity in ... character- ization and expression of escapin, a broadly antimicro- bial FAD-containing L-amino acid oxidase from ink of the sea hare Aplysia californica. J Exp Biol 20...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Optimization of conditions for the glycosyltransferase activity of penicillin-binding protein 1a from Thermotoga maritima ppt
... GAAACT TGTGCCGACC-3¢ and the reverse primer 5¢- TCACCAT CCAATTGATTAACCTCCTTCCATCAAAAACTTTTT CCAGATTTC-3¢. The fragment coding for the isolated GTase was PCR-amplified with the same forward primer and the ... fragment encoding the extracellular region of PBP 1a (accession number AAD35967.1) was PCR-amplified from T. maritima MSB8 genomic DNA with the forward primer 5¢- GAAAATCTGTATTTTCAGGGC...
Ngày tải lên: 29/03/2014, 21:20
Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf
... (1995) Small-Scale Preparation of Nuclear Extracts from Mammalian Cells. Academic Press, London. Supporting information The following supplementary material is available: Fig. S1. EGFP silencing efficacy of siRNAs at ... stabilities at each end. For example, siRNA 396 has guide strand sequence of 5¢-CAGGAUGUUGCCGUCCUCCTT-3¢ and a passenger strand sequence of 5¢-GGAGGACGGCAACAUCCUGT...
Ngày tải lên: 18/02/2014, 06:20