Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx

... views of the same data base, or the same view of a restructured data base. It can be interfaced with various data management systems currently it can access a relational data base via INGRES ... cransacclon number for the shlpmanc of bolts from Colonial co Ajax?" 3.2 DATA BASE TABLES The data base cables describe the data base as viewed by the data management system....

Ngày tải lên: 08/03/2014, 18:20

... assessment of examination scripts. Although there are many published analyses of the perfor- 180 mance of individual systems, as yet there is no pub- lically available shared dataset for training and ... Semantic Analysis (LSA) (Landauer et al., 2003), generative machine learning models (Rudner and Liang, 2002), domain-specific feature extraction (Attali and Burstein, 2006), and...

Ngày tải lên: 20/02/2014, 04:20

... on a gray background. (B) A scleractinian coral, Cyphastrea microphthalma, collected in 1.2 m of water off Lizard Island on the Aus- tralian Great Barrier Reef. (C) Overlay of the absorption (abs), ... applica- tions. Results Sequence of the new FP and relation to other known FPs A new FP, VFP, was isolated and cloned from the C. microphthalma coral, collected in 1.2 m of...

Ngày tải lên: 06/03/2014, 11:20

... primers annealing at the beginning and end of the cDNA and sequenced. Sequence analysis and homology modeling DNA and amino acid sequences were processed, analyzed and aligned with the vector nti software ... I PLA 2 s than UcPLA 2 (Fig. 3A) . Other known cnidarian PLA 2 s, such as those from the hydrozoan Hydra magni- papillata [34] and the sea anemones A. pallida [16,17] a...

Ngày tải lên: 06/03/2014, 11:20

... H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hamster ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarci...

Ngày tải lên: 07/03/2014, 09:20

... (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI restriction ... 5¢-GAT CTTTGC TACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢. The resulting 165-bp PCR product contained an Eco105I restriction site (under...

Ngày tải lên: 07/03/2014, 21:20

... 77 4agt_Arath 4 -a- glucanotransferase n.d. Arabidopsis thaliana AAL91204 955 77 4agt_Orysa 4 -a- glucanotransferase n.d. Oryza sativa BAC22431 922 77 (Dark red of Fig. 2) agwdArath a- glucan water dikinase ... 5511 M. Machovic ˇ et al. A new clan of CBM families 58 Nakamura Y, Kaneko T, Sato S, Mimuro M, Miyashita H, Tsuchiya T, Sasamoto S, Watanabe A, Kawashima K, Kishida Y, Kiyok...

Ngày tải lên: 07/03/2014, 21:20

... goal (whentype(sign,X,(farg(synsem,X,SynVal), whentype(synsem,SynVal,(farg(loc,SynVal,LocVal), whentype(local,LocVal,(farg(cat,LocVal,CatVal), whentype(category,CatVal,(farg(head,CatVal,HdVal), whentype(verb,HdVal, whentype(category,CatVal,(farg(marking,CatVal,MkVal), whentype(fin,MkVal, (X=synsem:loc:cat:head:vform:bse)))))))))))))). (5) ... the least appropriate type of any SYNSEM value,...

Ngày tải lên: 20/02/2014, 15:21

... were harvested immediately following irradiation and analysed for pyri- midine dimer formation. Non-irradiated cells and cells irradiated through a naked quartz plate served as controls. As can ... Typically, DNA damage is repaired at a relative high rate in human cells by various repair mechanisms including photoreactivation, nucleotide excision and global repair [19,20]. The...

Ngày tải lên: 07/03/2014, 15:20

... tool. 3 Or ˘ asan et al. (2000) enhanced the preference-based anaphora resolution algorithms by using a GA to find an optimal set of values for the outcomes of 14 indicators and apply the opti- mal combination ... important paragraphs from the text. Erkan and Radev (2004) and Mi- halcea (2005) introduced algorithms for unsuper- vised extractive summarization that rely on the...

Ngày tải lên: 07/03/2014, 22:20