Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity Nicola Barison 1,2 , Laura Cendron 1,2 , ... (Stratagene, La Jolla, CA, USA). The primers used were: 5¢-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis c...

Ngày tải lên: 16/03/2014, 00:20

... N-terminal region (N, aa 1–4 00), the first AAA-cassette (D1, aa39 4–6 81) and the second AAA- cassette (D2, aa66 9–1 043). DNA fragments encoding these parts of Pex1p were fused to the GAL4-AD and coexpressed ... studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction. The interaction of Pex1p...

Ngày tải lên: 07/03/2014, 16:20

... a- helix and the C-terminal b-strand of RBP and the hyper-variable regions of Fab: loops 5 3–5 6 and 10 0–1 03 and the short helix 2 8–3 2 of chain H and loops 3 1–3 6 and 5 3–5 6 of chain L. The interactions, which ... almost solvent exposed, in the region of the loops that con- nect b-strands A and B, C and D and E and F and surround...

Ngày tải lên: 30/03/2014, 02:20

... H atakeyama, S., Ishimoto, H., Tanimura, T., Tsuji, S., Kakizuka, A. , Kitagawa, M. & Nakayama, K.I. (2004) Molecular clearance of ataxin-3 is regulated by a mammalian E4. EMBO J. 23, 65 9–6 69. 132. ... Huntington disease ( HD), d entatorubral- pallidoluysian atrophy (DRPLA), and other spinocerebellar ataxia t ypes such as SCA1, SCA7 and SCA 17 [ 3–7 ]. T he a ge of onse...

Ngày tải lên: 30/03/2014, 15:20

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. Sun et al. ... as sense and antisense, respectively, for each mutation. p26 mutation Primer R110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC...

Ngày tải lên: 07/03/2014, 12:20

... N2 of the base makes a hydrogen bond to a main chain car- bonyl. Binding of a xanthine base from XMP in the same position, would lead to the loss of a hydrogen bond and a less favorable interaction. ... PRTFDC1 proteins have lost their phosphoribosyl- transferase activity [10]. The structural characterization of numerous com- plexes of the human HPRT and...

Ngày tải lên: 15/02/2014, 01:20

... ligand [1 7–1 9,24]. The attached flavoprotein and heme domains of NOS are also an unusual feature shared by only a handful of prokary- otic CYP proteins [4,8,25]. In comparison, the NOS flavoprotein ... has fundamen- tal structural, thermodynamic and mechanistic features in common with the dual-flavin family of reductases, there are unique aspects related to NO synthesis th...

Ngày tải lên: 18/02/2014, 11:20

... kJÆ mol )1 [9]. From the little experimental evidence cur- rently available, it appears that it is appropriate to describe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions ... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR with NADH. The wt trace is fit to a single exponential and the N18 9A t...

Ngày tải lên: 18/02/2014, 11:20

... protein flavin complexes and tailor the midpoint potentials in these proteins, as well as many details of the binding and electron transfer to protein and ligand partners, have been revealed. In addition ... M, Aoki S, Sato D, Kobayashi T, Kita K, Horii T & Hase T (2007) Cloning and characterization of ferredoxin and ferredoxin–NADP + reductase from human malaria pa...

Ngày tải lên: 18/02/2014, 11:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of the ... also. Overall structural features of the protein St SurE is an aba sandwich protein and adopts the Rossmann fold as in archaic and thermophilic homo- logues....

Ngày tải lên: 18/02/2014, 14:20