Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity doc

... Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity Nicola Barison1,2, Laura Cendron1,2, ... (Stratagene, La Jolla, CA,USA). The primers used were: 5¢-TATATCATTCAGGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3¢ (forward, the mutagenesis codon underlined) and 5¢-TTAGCGTATTCTAAAAGATACAAATAATCCTGAATGATATAAAAAC-3¢ ... has been identiﬁedas the starting point of the thiamin salvage pathway inB. halodurans [3], apparently cannot play the same rolein H. pylori because the amidohydrolase enzyme YlmBis also absent.In...

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... N-terminal region (N, aa 1–4 00), the ﬁrstAAA-cassette (D1, aa39 4–6 81) and the second AAA-cassette (D2, aa66 9–1 043). DNA fragments encodingthese parts of Pex1p were fused to the GAL4-AD and coexpressed ... studies of these AAA-peroxins and give a further detailed functional analysis of their cassettestructure and interaction. The interaction of Pex1p and Pex6p involvestheir ﬁrst AAA-cassettes ... 47functions and proteolysis [17,18]. AAA-proteins share the presence of one or two AAA-cassettes, comprisingabout 230 amino acids and are characterized by Wal-kerA and B motifs for ATP-binding and ATP-hydro-lysis...

Báo cáo khoa học: Structural and mutational analyses of protein–protein interactions between transthyretin and retinol-binding protein doc

... a- helix and the C-terminal b-strand of RBP and the hyper-variable regions of Fab: loops 5 3–5 6 and 10 0–1 03 and the short helix 2 8–3 2 of chain H and loops 3 1–3 6 and 5 3–5 6 of chain L. The interactions,which ... almostsolvent exposed, in the region of the loops that con-nect b-strands A and B, C and D and E and F and surround the entrance of the b-barrel at the openend of the cavity. As a result of ... Waltham, MA, USA).Crystallization, data collection, structuredetermination and reﬁnement for the TTR–RBP–Fab complex and the V20S and Y114 TTR variantsCrystallization and preliminary X-ray...

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

... H atakeyama, S., Ishimoto, H.,Tanimura, T., Tsuji, S., Kakizuka, A. , Kitagawa, M. &Nakayama, K.I. (2004) Molecular clearance of ataxin-3 isregulated by a mammalian E4. EMBO J. 23, 65 9–6 69.132. ... Huntington disease ( HD), d entatorubral-pallidoluysian atrophy (DRPLA), and other spinocerebellarataxia t ypes such as SCA1, SCA7 and SCA 17 [ 3–7 ]. T he a ge of onset of SCA2 and SCA3 is in the third ... consist of two g lobular domains named Lsm(Like S m, amino acid 25 4–3 45) [37] and LsmAD (Lsm-associated doma in, amino acid 35 3–4 75). The LsmADdomain of ataxin-2 contains both a clathrin-mediatedtrans-Golgi...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. Sun et al. ... assense and antisense, respectively, for each mutation.p26mutation PrimerR110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢F112R 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A ... Chaperones 8, 38 1– 394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- and aB-crystallins with early and late unfolding intermedi-ates of citrate...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from XMP in the same position, would lead to the loss of a hydrogenbond and a less favorable interaction. ... PRTFDC1 proteins have lost their phosphoribosyl-transferase activity [10]. The structural characterization of numerous com-plexes of the human HPRT and several bacterial and protozoan HPRTs have ... residues from the C-terminus and consists of a two-stranded anti-parallel b-sheet composed of b2 and b9 and an a- helix from the C-terminus (Fig. 1A) . The two subunits in the asymmetric unit, together...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... ligand [1 7–1 9,24]. The attachedﬂavoprotein and heme domains of NOS are also anunusual feature shared by only a handful of prokary-otic CYP proteins [4,8,25].In comparison, the NOS ﬂavoprotein ... has fundamen-tal structural, thermodynamic and mechanistic featuresin common with the dual-ﬂavin family of reductases,there are unique aspects related to NO synthesis thatconstrain and shape ... 50 and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated kon and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: probes of hydrogen tunnelling pptx

... kJÆmol)1[9]. From the little experimental evidence cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions ... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR withNADH. The wt trace is ﬁt to a single exponential and the N18 9A trace to a 4-exponential function – see the main text for ... substrate- binding titrations and crystallo-graphic studies when a very large amount of the sub-strate may be required; typical NAD(P)H saturationconstants for OYEs are 0.1-1 mm and as an example,a...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... protein ﬂavin complexes and tailor the midpoint potentials in these proteins, aswell as many details of the binding and electron transfer to protein and ligand partners, have been revealed. In addition ... M, Aoki S,Sato D, Kobayashi T, Kita K, Horii T & Hase T(2007) Cloning and characterization of ferredoxin and ferredoxin–NADP+reductase from human malariaparasite. J Biochem 141, 42 1–4 28.154 ... reductionpotentials and in the energetics of the FMN:apoproteininteraction in Anabaena ﬂavodoxin. Biochemistry 43,1511 1–1 5121.27 Fukuyama K, Wakabayashi S, Matsubara H & RogersLJ (1990) Tertiary...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of the ... also.Overall structural features of the protein St SurE is an aba sandwich protein and adopts the Rossmann fold as in archaic and thermophilic homo-logues. The St SurE monomer consists of 13 b-strands,six ... Katz JE, Beasley S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid...

Xem thêm