Development of a simple

Development of a simple

Development of a simple

... extraction procedure for SPM-associated trace metals, using a ligand competition approach with EDTA as the added complexing ligand. The use of EDTA allows the determination of available particulate ... been explained by an increase in major cation concentrations. Suspended particulate matter may consist of biological, organic and mineral phases [5] and each of these phases has a d...

Ngày tải lên: 15/03/2014, 23:56

15 410 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

... Thomson (2008) has also argued that concepts such as satisfaction are more appropriate than simple acceptance for commercial products, and that both brand and packaging need to be considered along with the ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy. Pizza and chocolate produced the strongest emotions based on Analysis of Variance. The terms active, adven...

Ngày tải lên: 03/04/2013, 21:07

10 782 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Marine Pests Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International ... vectors  International shipping, aquaculture and biodiversity are most threatened values  Amount of commercial shipping and number of trading partners affecting pathway strength...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masar...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... system we can now obtain weak optical signals, for example, Raman Spectra of Vietnam petrol extracts excited by not only an 2W Argon laser but also by a 30mW He-Ne laser. Key words: Raman spectroscopy, ... characters. A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator. The SR830 has a 256 character input b...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for G olf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of th...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... compressible atmospheric flows and air quality simulations. 4.1. The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation ... 93-106 93 Development of a software package for 3D structured mesh generation Duong Ngoc Hai, Nguyen Tat Thang * Institute of Mechanics, Vietnam Academy of Science a...

Ngày tải lên: 14/03/2014, 13:20

14 402 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... ABA had a higher OH • level after ParA1 treatment. H 2 O, H 2 O pretreatment; H + ParA1, ParA1 infiltration after H 2 O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ... oligonucleotide prim- ers: 5¢-TGAATTC AATAATGTCTAACTTCCGCGCTCT- GTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢. For the suc- cessful protein expression, a yeast expr...

Ngày tải lên: 15/03/2014, 00:20

15 479 0
w