Bacteria constitute a large domain of prokaryotic microorganisms

Bacteria constitute a large domain of prokaryotic microorganisms.

Bacteria constitute a large domain of prokaryotic microorganisms.

... survive. EUBACTERIA AND ARCHAEBACTERIA: The two bacterial kingdoms Bacteria on a pin head Eubacteria • “True” bacteria • largest Kindgom of prokaryotes • generally surrounded by cell wall composed of ... layer of lipid and carbohydrate – picked up safranine – appeared red GRAM NEGATIVE Bacterial movement • propelled by flagella • lash, snake, or spiral forward • no movement B...

Ngày tải lên: 15/03/2014, 13:09

40 267 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ Y. Sun et al. ... as sense and antisense, respectively, for each mutation. p26 mutation Primer R110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

... locally optimal. 2.3 Local optimization of cuts A cut is called locally optimal regarding quality function if each cut which is only a small modification of the original does not have greater quality, ... @ufal.mff.cuni.cz jiri.divis@atlas.cz Abstract We describe an original method that automatically finds specific topics in a large collection of texts. Each topic is first identified...

Ngày tải lên: 08/03/2014, 04:22

6 447 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

. accept credit cards. A large amount of, a great deal of , a large number of Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a great deal of là danh từ không đếm được.. Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of Không có sự khác nhau nhiều gi a a lot of và lots of. A lot of và lots of đều mang tính chất thân mật,. *...

Ngày tải lên: 02/04/2014, 13:20

6 1,7K 11
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... (5) and insufficient (6). Y-axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients...

Ngày tải lên: 03/11/2012, 11:44

9 679 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... cttgtacacaccgcccgtc Primer and Probe Sequence (5’-3’) Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc QMT ... Toxicology and Water Quality., 13, 61-72. Park H. D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A. and Kato K. (2001). Degradation of the cyanobacterial hepatotoxin microcystin by a...

Ngày tải lên: 05/09/2013, 10:15

9 522 0
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt

Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt

... not crawlable. It is also a result of anchor text. All of the results are reasonably high quality pages and, at last check, none were broken links. This is largely because they all have high PageRank. ... running a crawler which connects to more than half a million servers, and generates tens of millions of log entries generates a fair amount of email and phone calls. Becaus...

Ngày tải lên: 24/01/2014, 20:20

20 572 0
Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx

Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx

... Medical City, Riyadh, Saudi Arabia (Abdullah A. Alshimemeri, Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, and Othman Al Harbi) and Ministry of Health, Riyadh, Saudi Arabia (Ziad Memish) Address ... Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, Othman Al Harbi, Ziad Memish Crit Care & Shock (2011) 14:1-6 Abstract Objective: To examine the presentation and outcome of patie...

Ngày tải lên: 15/02/2014, 12:20

6 506 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... strain, as expected, was respira- tory-deficient because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for b...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix. The SEA domain ... analysis of DESC1 suggests a possible rigid domain association between the N-terminal SEA domain and the back site of the proteinase domain. This interaction would fix the SEA...

Ngày tải lên: 19/02/2014, 00:20

13 588 0
w