3  creating a large number of users

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

... Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, navigation, and air traffic management, with special stress on data fusion ... respect to the radar (radial and tangential projection of velocity heading), magnitude of the transversal acceleration, and magnitude of the groundspeed change There are four quality parameters in ... conditions are classified with respect to radar and aircraft characteristics because of the very different behavior of any tracker for varying input conditions Radar parameters represent the accuracy and...

Ngày tải lên: 23/06/2014, 00:20

14 342 0
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

... Biosystems) Data Our data are freely available at the proteome database of the department of proteomics and signal transduction of the Max-Planck-Institut for Biochemistry [45] Additional data files ... following additional data are available with the online version of this paper Additional data file lists all peptides and protein hits obtained in both LTQ-FT and LTQ-Orbitrap data Click here data Orbitrap ... CTSD Cathepsin G CTSG Cathepsin Z CTSZ Prostasin† PRSS8 Aminopeptidase B† RNPEP Tissue alpha-L-fucosidase FUCA1 12 Beta-mannosidase* MANBA 13 Alpha-N-acetylglucosaminidase* NAGLU 12 Neuraminidase...

Ngày tải lên: 14/08/2014, 17:22

11 289 0
Tài liệu Module 3: Creating a Custom Team Folder Template doc

Tài liệu Module 3: Creating a Custom Team Folder Template doc

... 1=Calendar,calendar.htm,\ Module 3: Creating a Custom Team Folder Template 33 Creating a Template Data Folder Slide Objective To show the location of a template data folder that contains a WebView ... [Strings] CalendarName=Calendar CalendarName=Calendar [Folders] [Folders] 1=%CalendarName%,calendar.htm,\ 1=%CalendarName%,calendar.htm,\ Before the Team Folders Wizard processes the entry, it replaces ... Templates, associate views with these templates, create an administration folder, and register templates Creating a Folder Home Page Creating an Administration Folder Home Page Creating a Template Initialization...

Ngày tải lên: 11/12/2013, 14:15

56 474 0
Tài liệu Module 3: Creating a Windows Installer Package doc

Tài liệu Module 3: Creating a Windows Installer Package doc

... Software Use a Third-Party Repackaging Use a Third-Party Repackaging Application to Repackage an Application to Repackage an Application Application Install the Package from Removable Install ... create a Windows Installer package by repackaging the application Repackaging an application means creating a Windows Installer package for that application based on the installation and configuration ... package and a repackaged Windows Installer package Repackage an application as a Windows Installer package by using the WinINSTALL LE third-party repackaging application Modify a Windows Installer...

Ngày tải lên: 21/12/2013, 05:18

34 366 0
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

... Information and Communication Technologies, pages 311–316 Trinity College Dublin, Ireland JAMA 2004 JAMA: A Java Matrix Package Publicdomain, http://math.nist.gov/javanumerics/jama/ Leonard Kaufman ... sort of machine learning, using a small manually annotated collection of texts When optimized -parameters are used, the Local Search procedure tries to simulate the behavior of human annotator ... Document ranking against a query is based on statistical correlation between query words and words in a document Since a document is a small sample of text, the statistics in a document are often...

Ngày tải lên: 08/03/2014, 04:22

6 447 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACAGTTTAGCTCGGTACC CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT ... AAAATGGCCTACAGTTTAGCTCGGTACC CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT named according to the amino-acid residues substituted by alanine and their respective position...

Ngày tải lên: 08/03/2014, 16:20

7 404 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... historical inflation Model-derived inflation expectations also have a number of advantages over expectations from market economists: unlike survey-based expectations, they are again available at any ... inflation expectations and inflation risk premia Due to a lack of data, we cannot this, and instead we estimate inflation forward rates as part of our model Vol No Estimating Inflation Expectations...

Ngày tải lên: 15/03/2014, 07:20

32 347 0
Bacteria constitute a large domain of prokaryotic microorganisms.

Bacteria constitute a large domain of prokaryotic microorganisms.

... example PROKARYOTIC CELLS • Prokaryote – what does that mean? Classification of Prokaryotes • All prokaryotes were in kingdom Monera • Now – kingdoms – Eubacteria and archaebacteria Archaebacteria ... things They are dependent on living things to survive EUBACTERIA AND ARCHAEBACTERIA: The two bacterial kingdoms Bacteria on a pin head Eubacteria • “True” bacteria • largest Kindgom of prokaryotes ... between bacterial and viral DNA RNA polymerase causes mRNA to be made from cell for virus Viral DNA takes over and produces more DNA and viral proteins Replication – Virus uses bacterial material to...

Ngày tải lên: 15/03/2014, 13:09

40 267 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... design of potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate inflation ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... inflation expectations and inflation risk premia Due to a lack of data we cannot this and instead estimate inflation forward rates as part of our model 18 inflation, a low 2-year break-even inflation...

Ngày tải lên: 22/03/2014, 20:20

39 395 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... polypeptide was characterized by western blotting, amino acid analysis and N-terminal Edman sequencing (data not shown) MS analysis showed that the isolated CT-peptide had a molecular mass within Da of ... recognition and cleavages of natural substrates, and the intrinsic stability of the enzyme [7,9] Furthermore, it has also been reported that the CT-peptide may act as a partial inhibitor of PC1 ⁄ ... enzymatic activity of PC1 ⁄ has also been ascribed to a potential endogenous inhibitor, proSAAS [3] Enzymatically active PC1 ⁄ is generated via a series of irreversible proteolytic cleavages of...

Ngày tải lên: 30/03/2014, 08:20

10 305 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

... trọng Sau A large amount of a great deal of danh từ không đếm Ví dụ: * She has spent a great deal of time in Europe Sau A large number of trước danh từ số nhiều, động từ theo sau chia theo chủ ... danh từ số nhiều Ví dụ: * There is plenty of time * Plenty of shops accept credit cards A large amount of, a great deal of , a large number of Cách diễn đạt mang tính tương đối trang trọng Sau ... động từ chia tương ứng với dạng số nhiều Ví dụ: * A lot of my friends live abroad * Lots of time is needed to learn a language Plenty of Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không...

Ngày tải lên: 02/04/2014, 13:20

6 1,7K 11
báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

... include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient privacy) b) by observing patients' ability ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... committee of the American College of Physicians specifically supported the view that maintenance of a patient's functional well-being is a fundamental goal of medical practice They also noted that the...

Ngày tải lên: 18/06/2014, 19:20

9 477 0
báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx

báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx

... covariates as mentioned above More than a quarter of the patients received some acupuncture during the last half year and nearly a quarter visited a traditional healer at least once ANCOVAs revealed ... (PHQ-scores), and HSU were made by ANCOVAs adjusted for covariates that may have substantial influence such as age, disease duration, comorbidities and QoL (AIMS2-SF scales assessing pain, physical limitation ... care as well as patients' quality of life by tailored interventions A randomly created sample of 75 general practitioners in the area of Baden-Wuerttemberg and Bavaria has been enrolled and recruited...

Ngày tải lên: 20/06/2014, 00:20

9 413 0
báo cáo hóa học:" Male gender predicts mortality in a large cohort of patients receiving antiretroviral therapy in Uganda" ppt

báo cáo hóa học:" Male gender predicts mortality in a large cohort of patients receiving antiretroviral therapy in Uganda" ppt

... Sterne JA, Dabis F, Egger M, IeDEA Southern Africa and West Africa: Prognosis of patients with HIV-1 infection starting antiretroviral therapy in subSaharan Africa: a collaborative analysis of scale-up ... publication Author details Faculty of Health Sciences, University of Ottawa, Ottawa, Canada 2British Columbia Centre for Excellence in HIV/AIDS, Vancouver, Canada 3The AIDS Support Organization (TASO), ... households, and plan for their interventions appropriately Additional material Additional file 1: Analysis according to unadjusted data Acknowledgements The Canadian Institutes of Health Research sponsored...

Ngày tải lên: 20/06/2014, 08:20

7 256 0
báo cáo hóa học:" Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" pptx

báo cáo hóa học:" Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" pptx

... include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient privacy) b) by observing patients' ability ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... committee of the American College of Physicians specifically supported the view that maintenance of a patient's functional well-being is a fundamental goal of medical practice They also noted that the...

Ngày tải lên: 20/06/2014, 16:20

9 370 0
Báo cáo hóa học: " Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression" pptx

Báo cáo hóa học: " Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression" pptx

... individual as the object to be optimized The character data of the individual is the parameters to be optimized in an evolutionary-based process These parameters are arranged as vectors of real numbers ... , w and h are initial spatial coordinates, and w0 , h0 , A, B, C, and D are parameters The y-coordinate remains the same while the x-coordinate is transformed as a function of both coordinates ... research interests are in computational biology and bioinformatics, web databases, data mining, artificial intelligence, evolutionary computations, animates, artificial life, and evolutionary biology...

Ngày tải lên: 23/06/2014, 01:20

10 256 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of. potx

Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of. potx

... large number of Cách diễn đạt mang tính tương đối trang trọng Sau A large amount of a great deal of danh từ không đếm Ví dụ: * She has spent a great deal of time in Europe Sau A large number of ... Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không đếm danh từ số nhiều Ví * * dụ: There Plenty is of shops plenty accept of time credit cards A large amount of, a great deal of , a large ... diễn đạt mang ngh a tương tự như: much, many most, mặt ngữ pháp không hẳn giống Theo sau từ a lot, lots, plenty, a large amount a great deal giới từ Of Ví dụ: * Plenty of shops open on Sunday mornings...

Ngày tải lên: 27/07/2014, 15:21

5 558 0
w