Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

... Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation Andrei M. Vacaru 1 and Jeroen den Hertog 1,2 1 ... these results indicate that catalytically active RPTPa-D2 is required for binding and activation of Src. Discussion Here we report that inactivating mutations in the m...

Ngày tải lên: 15/03/2014, 10:20

... not manually annotate a large portion of the MZEE cor- pus, the training data consisted of the disjoint sub- sets of the English and German CELEX wordlists (Baayen et al., 1995), as well as the ... classified separately, and if the maximum anglicism classifier score out of all splits exceeds a target confidence c (=0.7), the orig- inal word is labeled a candidate anglicism. Param...

Ngày tải lên: 19/02/2014, 19:20

... GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ... characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Ram Savan 1 , Daisuke Igawa 2 and Masahiro Sakai 2 1 United Gradu...

Ngày tải lên: 20/02/2014, 02:21

... of a- cyano-4-hydroxycinnamic acid in acetone). Mass spectra were obtained with an autoFLEX II TOF ⁄ TOF (Bruker Daltonics, Billerica, MA, USA), and the data were ana- lyzed by a mascot search against the SwissProt ... Science and Technology of Japan, Health and Sciences Research Grants (Toxicoge- nomics) from the Ministry of Health, Labor and Wel- fare of Japan (Y. Sakakibara), Ja...

Ngày tải lên: 06/03/2014, 22:21

... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, and amino acid sequence of cerato-platanin, a new phyto- toxic protein fro...

Ngày tải lên: 07/03/2014, 12:20

... naturally occurring conopep- tide in chromatography studies. This is particularly applic- able for a- conotoxins because there are a manageable number of potential disulfide isomer variants. Authenticity is ... ammonium bicarbonate for disulfide formation; g, Synthesised by tBoc assembly, HF cleavage and air oxidation in ammonium bicarbonate for disulfide formation; N /A, not avai...

Ngày tải lên: 19/02/2014, 12:20

... bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain Naoto Ohtani 1 , Natsumi Saito 1 , Masaru Tomita 1 , Mitsuhiro Itaya 1,2 and Aya Itoh 1 1 Institute for Advanced Biosciences, ... 88, 12–19. 19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of the first archaeal type 1 RNase H gene from Halobacterium sp. NRC-1: archaeal RNase HI c...

Ngày tải lên: 19/02/2014, 18:20

... are linked to diseases and used as diagnostic markers (e.g. proapoA-I is associated with Tangier’s disease, CgA is a diagnostic marker of a variety of neuroendocrine mark- ers and chronic heart failure, ... vivo. ProapoA-I has also been linked to Tang- ier disease, a disease with abnormally low levels of apoA-I and HDL. In Tangier disease, proapoA-I is present in approximate...

Ngày tải lên: 07/03/2014, 05:20

... 671–677. 33. Hanada, K., Palacpac, N.M.Q., Magistrado, P .A. , Kurokawa, K., Rai, G., Sakata, D., Hara, T., Horii, T., Nishijima, M. & Mitamura, T. (2002) Plasmodium falciparum phospholipase C hydrolyzing ... of GSL biosynthesis was shown. The particular substrate specificity of the malarial GCS suggests that this enzyme might represent a new attractive target for malarial chemothe...

Ngày tải lên: 07/03/2014, 15:20

... protein. This is in part explained by the fact that p35 and p40 components are already covalently a ssociated through a disulfide bridge leading to a stable association. Many examples of cytokine receptors ... 1B, left panel). SDS/PAGE analysis r evealed a single band displaying an ap parent m olecular weight o f 85 kDa, which was quantified based on known concentrations of BSA ru...

Ngày tải lên: 08/03/2014, 10:20