Báo cáo khoa học: Trafficking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase pot

Báo cáo khoa học: Trafficking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase pot

Báo cáo khoa học: Trafficking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase pot

... MINIREVIEW Trafficking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase Jeffrey P. Bocock 1 , Stephanie Carmicle 2 , Mayukh Sircar 1 and Ann H. Erickson 1 1 ... extracellularly as a ligand that either acts as a juxtacrine factor or mediates transactivation of a distant unknown recep- tor. Ectodomain cleavag...

Ngày tải lên: 15/03/2014, 00:20

9 285 0
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

... factor 1 homeodomain – hints from 15 N-NMR relaxation studies Devrim Gu ¨ mral, Luana Nadalin, Alessandra Corazza, Federico Fogolari, Giuseppe Damante, Paolo Viglino and Gennaro Esposito Dipartimento ... MF- based fitting of the majority of the TTF-1 HD relaxa- tion data could be attributed to correlated local dynamics that occur on a timescale similar to that of the overall tumbling...

Ngày tải lên: 18/02/2014, 16:20

14 744 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations as well as assignments of add...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

... influenzae, Streptococcus pneumoniae, Branhamella catarrhalis and the pathogenic fungi Aspergillus fumigatus and Candida albicans, in addition to P. aerugin- osa and S. aureus. A similar antimicrobial ... the pathogenic fungi A. fumigatus and C. albicans. Our results indicate that trappin-2 has a broad antibacte- rial activity and is fungicidal for A. fumigatus and C. albican...

Ngày tải lên: 18/02/2014, 17:20

13 610 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... replicative primases (AEPs) [11]. Primase–polymerases (prim–pols) are a novel family of AEPs which are sporadically found in both bacterio- phages and crenarchaeal and Gram-positive bacterial plasmids. ... multifunctional nature, archaeal DNA primases share a number of features with eukar- yal ones and are consequently subsumed within the superfamily of structurally related...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan ... fw, forward; rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD r...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... enzymatic characterization of HpSDH demonstrates its activity with k cat of 7.7 s )1 and K m of 0.148 mm toward shikimate, k cat of 7.1 s )1 and K m of 0.182 mm toward NADP, k cat of 5.2 s )1 and ... essential for the synthesis of important metabolites, such as aromatic amino acids, folic acid, and ubiquinone [10]. The shikimate pathway is crucial to algae, higher plants...

Ngày tải lên: 19/02/2014, 05:20

11 529 0
Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

... PKB ⁄ Akt and PDK1, mediates S6K activa- tion [4]. Another major player in the activation of S6K is the mammalian target of rapamycin, mTor (FRAP) which senses the level of amino acids and possibly other ... phosphatase 2A interacts with the 70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein. Proc Natl Acad Sci USA 96, 4438–4442. 11 Petritsch...

Ngày tải lên: 19/02/2014, 07:20

14 630 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... Teruna J. Siahaan 3 and Seetharama D. S. Jois 1 1 Department of Pharmacy and 2 Department of Microbiology, National University of Singapore, Singapore; 3 Department of Pharmaceutical Chemistry, ... families o f conformers that satisfied the NMR data were obtained. An average structure was taken from e ach f amily t o represent the family. Based on ROE violation > 0.2 A ˚ and...

Ngày tải lên: 19/02/2014, 13:20

14 658 0
Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf

Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf

... as a substrate, and the absorbance was measured at 490 nm by using a Spectramax plate reader and software (Molecular Devices, Sunnyvale, CA, USA). All values were interpolated from either a log- log ... Fatty acid methyl e ster (FAME) analysis, GLC and GLC-MS indicated that the majority of fatty acids contained in Spirochaeta aurantia LGL B are either branched or unsaturated. Va...

Ngày tải lên: 19/02/2014, 16:20

11 632 0
w