Báo cáo khoa học: Trafﬁcking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase pot

... MINIREVIEW Trafﬁcking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase Jeffrey P. Bocock1, Stephanie Carmicle2, Mayukh Sircar1 and Ann H. Erickson11 ... extracellularlyas a ligand that either acts as a juxtacrine factor ormediates transactivation of a distant unknown recep-tor. Ectodomain cleavage would terminate RING-med-iated ubiquitination ... 2, lanes 5 and 6). Proteolytic cleavage of the N-terminal protease-asso-ciated (PA) luminal domain or ectodomain must occurbecause 43 and 39 kDa membrane- bound CTFs lack-ing the HA tag are...

Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

... factor 1 homeodomain – hints from15N-NMRrelaxation studiesDevrim Gu¨mral, Luana Nadalin, Alessandra Corazza, Federico Fogolari, Giuseppe Damante,Paolo Viglino and Gennaro EspositoDipartimento ... MF-based ﬁtting of the majority of the TTF-1 HD relaxa-tion data could be attributed to correlated localdynamics that occur on a timescale similar to that of the overall tumbling.Graphical analysis ... values were calculated from the height ratio of thepeaks of 2D correlation spectra obtained with and withoutproton saturation, whereas the cross-relaxation rates, RNOE,were calculated according...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but ... crosspeaks were assigned and inte-grated, with concomitant cycles of structure calcula-tions for evaluation of distance and angle constraintviolations as well as assignments of additional peaksbased ... D-amino acid in peptide link-age by an enzyme from frog skin secretions. Proc NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K &...

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elaﬁn) do not depend on its protease inhibitory function pptx

... inﬂuenzae,Streptococcus pneumoniae, Branhamella catarrhalis and the pathogenicfungi Aspergillus fumigatus and Candida albicans, in addition to P. aerugin-osa and S. aureus. A similar antimicrobial ... thepathogenic fungi A. fumigatus and C. albicans. Ourresults indicate that trappin-2 has a broad antibacte-rial activity and is fungicidal for A. fumigatus and C. albicans. Using trappin-2 A6 2D ... been shown to have antibacterial and antifungal properties, whereasrecent data indicate that trappin-2 has antimicrobial activity against Pseu-domonas aeruginosa and Staphylococcus aureus. In the...

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... replicative primases (AEPs) [11].Primase–polymerases (prim–pols) are a novel family of AEPs which are sporadically found in both bacterio-phages and crenarchaeal and Gram-positive bacterialplasmids. ... multifunctional nature, archaealDNA primases share a number of features with eukar-yal ones and are consequently subsumed within thesuperfamily of structurally related proteins calledarchaeo-eukaryotic ... shortest functional domain from a crenarchaeal plasmid endowed withDNA and RNA synthesis and terminal transferase activity.AbbreviationsAEP, archaeo-eukaryotic replicative primases; dNTP, deoxyribonucleotide;...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan ... fw, forward; rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time ... Ala wascarried out using the QuickChange kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢...

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... enzymatic characterization of HpSDH demonstrates its activity with kcat of 7.7 s)1 and Km of 0.148 mmtoward shikimate, kcat of 7.1 s)1 and Km of 0.182 mm toward NADP, kcat of 5.2 s)1 and ... essential for the synthesis of importantmetabolites, such as aromatic amino acids, folic acid, and ubiquinone [10]. The shikimate pathway is crucialto algae, higher plants, bacteria and fungi, ... can oxidize shiki-mate using NAD as cofactor, which has a kcat of 5.2 ± 0.1 s)1 and Km of 2.9 ± 0.4 mm toward NAD.HpSDH shows a 10 times higher Kmfor NAD thanfor NADP at saturation of...

Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

... PKB ⁄ Akt and PDK1, mediates S6K activa-tion [4]. Another major player in the activation of S6Kis the mammalian target of rapamycin, mTor (FRAP)which senses the level of amino acids and possiblyother ... phosphatase 2A interacts with the70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein. Proc Natl AcadSci USA 96, 4438–4442.11 Petritsch C, Beug H, Balmain A & ... proteinkinase-1 (PDK1). AGC kinases share a high homologyin their kinase domains and have a similar mode of activation [1].There are two isoforms of S6 kinase, S6K1 and 2.Both have highly...

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... Teruna J. Siahaan3 and Seetharama D. S. Jois11Department of Pharmacy and 2Department of Microbiology, National University of Singapore, Singapore;3Department of Pharmaceutical Chemistry, ... families o fconformers that satisﬁed the NMR data were obtained.An average structure was taken from e ach f amily t orepresent the family. Based on ROE violation > 0.2 A ˚ and allowed values ... of /, w in the Ramachandran map, only one family of structure th at was consistent with NMR data waschosen to represent the conformation of peptide cER. A family of low energy structures that...

Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf

... as a substrate, and theabsorbance was measured at 490 nm by using a Spectramaxplate reader and software (Molecular Devices, Sunnyvale,CA, USA). All values were interpolated from either a log-log ... Fatty acid methyl e ster (FAME) analysis, GLC and GLC-MSindicated that the majority of fatty acids contained in Spirochaetaaurantia LGLBare either branched or unsaturated. Values stated a ... theaverage n molÆmg)1with standard deviations (±) obtained fromquantifying and averaging areas under speciﬁc peaks from GLCanalysis of four separate samples of LGLB.Identity of fatty acid...

Xem thêm