Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot
... by the concentra- tion dependence of the conformational transition. Relatively small variations of protein concentration also lead to an increase of the rates at which the con- formational transition ... 1921 On the aggregation properties of FMRP – a link with the FXTAS syndrome? Ljiljana Sjekloc ´ a* , Kris Pauwels and Annalisa Pastore MRC National...
Ngày tải lên: 14/03/2014, 23:20
... P, was determined, while allowing the remaining K d and maximum absorbance change at satura- tion (A 1 ) to float. Resonance Raman and electronic absorption spectroscopy For resonance Raman and ... Fe-His bond and hence on the status of the proximal His H-bond. It appears that one can readily rationalize the general trends but not the magnitude of the chan- ges seen. Entropy...
Ngày tải lên: 07/03/2014, 21:20
... domain has fundamen- tal structural, thermodynamic and mechanistic features in common with the dual-flavin family of reductases, there are unique aspects related to NO synthesis that constrain and ... the Ca 2+ -binding protein calmodulin (CaM) to enable their participation in biological signaling cascades. By contrast, iNOS binds CaM regardless of the Ca 2+ concentration and can r...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... of sipW W10 AACACACAGAATAATCGGGATCAC Cloning of sipW W11 GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWh W12 CGAGATCTTGTGGACATGGTCCCGTTTC Construction of pOpacWh S1 CGGAATTCGCTAATGGGAGGAAATCAC ... CAGCAATTGACCCTTAGGAGTTGGCAT Construction of pOpacBh Lep2 GATGGATCTATGGATGCCGCCAATG Construction of pOpacBh Omp1 GCAAAGCTTATTTTGGATGATAACGAGGCG Construction of pOpac Omp2 GCGAATTCCT...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx
... P763 (5¢-TTCTCGAGACGCGTTATCGATAGAGAAATGT TCTGGC-3¢) and digested the PCR product with EcoRI and XhoI. The insert was synthesized with primers P764 (5¢-AACTCGAGGCTAGTCTGCAGGAGCTCAAGCT TTCTAGAGAATTCA-3¢)andP765(5¢-TGAATTCTC TAGAAAGCTTGAGCTCCTGCAGACTAGCCTCGA GTT-3¢). ... adenylate cyclase with the exception of an artificial isoform (CRFR1h2) with the insertion of 37 amino acid...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: "Bilingual Hebrew-English Generation of Possessives and Partitives: Raising the Input Abstraction Level" pptx
... non-possessive relation: * Simlatah Sel ha-Sabat * dress-cs-her of the- Shabat Similarly, the possible realizations of the partitive are controlled by the feature realize-partitive-as: of ... selection of the unmarked realization option and the deter- mination of the default value of the definite feature remain difficult and vary a lot be- tween the t...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... enzy- matic activity plays a fundamental role in the biosynthesis of methylated dianthramide-derivatives, the carnation phyto- alexins. However, no data are available regarding the role of this ... v/v); separation was performed isocratically, at a flow rate of 1mLÆmin )1 , and the volume of injected samples was 10 lL. The amounts of the residual initial phenolic subs...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA). The primers used were: 5¢-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3¢ ... reaction was monitored by monitoring the decrease in A 340 as a result of the enzymatic con- sumption of NADPH. The HP1287 enzyme concentration was calculated...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Human anionic trypsinogen Properties of autocatalytic activation and degradation and implications in pancreatic diseases potx
... trypsin(ogen) degradation. Only in millimolar Ca 2+ concentrations was significant autoactivation detected, when the rate of auto- activation exceeded the rate of degradation. In contrast, because degradation of ... concentration dependence. The apparent half-maxi- mal stimulatory Ca 2+ concentration (15 l M ) was compar- able to the Ca 2+ concentration that stabilized cationic t...
Ngày tải lên: 17/03/2014, 03:20
Tài liệu Báo cáo khoa học: On the mechanism of action of the antifungal agent propionate Propionyl-CoA inhibits glucose metabolism in Aspergillus nidulans doc
... bicarbon- ate increased the growth rate again, probably because it stimulated the degradation of propionyl-CoA via methyl- malonyl-CoA [12]. It was also shown that a ccumulation of Correspondence ... length of light path of the cuvette], which con siders the decrease of the concentration of oxaloacetate in equilibrium with L -malate during t he formation o f NADH (th...
Ngày tải lên: 19/02/2014, 16:20