UNISEXUAL SALAMANDERS (GENUS AMBYSTOMA) PRESENT A NEW REPRODUCTIVE MODE FOR EUKARYOTES doc

... mito- chondrial lineages in spotted salamanders (Ambystoma macula- tum). Evolution, 57: 1631–1652. 136 Genome Vol. 50, 2007 # 2007 NRC Canada Unisexual salamanders (genus Ambystoma) present a new reproductive ... 109–134. Bogart, J.P., and Klemens, M.W. 1997. Hybrids and genetic inter- actions of mole salamanders (Ambystoma jeffersonianum and A. laterale) (Amphibia: Cau...

Ngày tải lên: 14/03/2014, 16:20

... of nucleoli appearance and disappearance. Nucleoli are not distinguishable before simple follicle formation in Octopoteuthis sicula, Sepia bertheloti and Abraliopsis atlantica. In Argonauta argo and Pteriqioteutnis gemmata, at ... male cephalopods, stages IV and Vare short and perhaps of little ecological importance since they have to accumulate a large quantity of spermatophores in the Nee...

Ngày tải lên: 14/03/2014, 16:20

... image. We used all seven TM spectral bands and geospatial ancillary data, the coordinate values of each pixel, as inputs since geospatial ancillary data improves accuracy (Park and Stenstrom, ... area in Santa Monica Bay Watershed. The results suggest an improved classification system for stormwater modeling, using open land use as low pollutant loading areas and transportation land .....

Ngày tải lên: 05/09/2013, 09:08

... used for EFA, and the remaining 266 observations composed the CFA sample. Exploratory Factor Analysis(EFA). EFA was conducted in SPSS using Principal Axis Factoring with Varimax rotation. The a ... is not an enduring personality trait that is generalizable acrosssituations. Rather, it is a relatively stable psychologicalstate. In terms of temporalstability (i.e, malleability), variance...

Ngày tải lên: 07/09/2013, 11:05

... 2010) MARCIA S. SMITH, Director (until March 1, 2009) CARMELA J. CHAMBERLAIN, Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A. NAYLOR, Information Management Associate ... HENNE, Gulfstream Aerospace Corporation RICHARD KOHRS, Independent Consultant IVETT LEYVA, Air Force Research Laboratory, Edwards Air Force Base ELAINE S. ORAN, Naval Research Laborato...

Ngày tải lên: 05/03/2014, 11:21

... A NEW CAR PLAN FOR A GREENER FUTURE | 5 4 | A NEW CAR PLAN FOR A GREENER FUTURE | 5 ExECUTIvE SUMMARy A New Car Plan for a Greener Future is the Australian Government’s plan to give our automotive ... is about mutual obligation all round – a genuine partnership. The new car plan acknowledges that all Australians benet from having a healthy automotive indust...

Ngày tải lên: 07/03/2014, 11:20

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... the 3¢-UTR, a PCR was performed using Pnr ⁄ BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGC...

Ngày tải lên: 07/03/2014, 21:20

... Multilingual QA Yutaka Sasaki Department of Natural Language Processing ATR Spoken Language Communication Research Laboratories 2-2-2 Hikaridai, Seika-cho, Soraku-gun, Kyoto, 619-0288 Japan yutaka.sasaki@atr.jp Abstract This ... whether an answer is correct is done by both automatic and manual evaluation. Auto- matic evaluation consists of exact matching and par- tial matching. Partial matchi...

Ngày tải lên: 08/03/2014, 04:22

... 1988; Parasuraman, Zeithaml, and Berry 1988) •Value and supply chain management (Normann and Ramirez 1993; Srivastava, Shervani, and Fahey 1999) •Resource management (Constantin and Lusch 1994; Day ... Consequences,” in Handbook of Relationship Marketing, Jagdish Sheth and A. Parvatiyar, eds. Thousand Oaks, CA: Sage Publications. ———, Rajendra S. Sisodia, and Arun Sharma (2000), “The Antece...

Ngày tải lên: 15/03/2014, 22:20

... 4: Manual Evaluations Here, we manually evaluate quality of summaries, a common DUC task. Human annotators are given two sets of summary text for each document set, generated from two approaches: ... particularly ap- pealing to summarization than a ”flat” model, e.g. LDA (Blei et al., 2003b), in that one can discover ”abstract” and ”specific” topics. For instance, dis- covering that ”ba...

Ngày tải lên: 20/02/2014, 04:20