Báo cáo " Acoustomagnetoelectric effect in a superlattice " ppt

Báo cáo " Wavelength shift in microsphere lasers " pptx

Báo cáo " Wavelength shift in microsphere lasers " pptx

... i.e. adjusting the distance from tip to acceptance point we may also find the appropriate position to select one lasing mode. a) b) Fig. 3. Selecting a single laser mode by changing the acceptance ... must adjust the frequency of the excitation beam to a WGM resonance and align the excitation beam so that it also has an angular momentum matched the angular momentum of that mode. There ar...

Ngày tải lên: 05/03/2014, 14:20

8 276 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... significant sample group. This combination was possible because both the dynamic and catalytic parameters derived Table 4. Kinetic parameters for the a- CT-, lactose -a- CT-, and dextran -a- CT catalyzed ... (Suc-Ala-Ala-Pro-Phe-pNA) revealed decreased kinetics for the catalytic steps (k 2 and k 3 ) without affecting sub- strate binding (K S ) at increasing glycosylation levels. Statistical c...

Ngày tải lên: 19/02/2014, 05:20

17 531 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... compounding). The baseline classifier We used MALLET (Mc- Callum, 2002) to train a maximum entropy classi- fier, using character 1- through 6-grams (including word boundaries) as features. Since we ... Type- and token-based precision at recall=95 from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009). Compound-cutting Nominal and adjectival com- pounding is commo...

Ngày tải lên: 19/02/2014, 19:20

5 538 0
Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

... sampling rate of 25 kHz, with the aid of a computer equipped with an analogue-to-digital interface board (DT 2821; Data Translation, Marlboro, MA, USA). Computerized data acquisition and analysis were ... calculated molecular masses for native PIN -a and a1 -PTH. PIN -a forms ionic channels in giant liposomes Seals of high-resistance and excised patches in an ‘inside out’ configuratio...

Ngày tải lên: 07/03/2014, 12:20

13 436 0
Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx

Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx

... meetings) are characterized by pragmatic rather than strategic topic shifts. Second, agenda- setting roles are clearer in formal debates; a modera- tor is tasked with setting the agenda and ensuring ... value. 2 http://www.cs.umd.edu/ ∼ vietan/topicshift/appendix.pdf 3 We also investigated using the maximal assumption and fully sampling assignments. We found the minimal path assump- tion...

Ngày tải lên: 07/03/2014, 18:20

10 555 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

... Propynoate metabolic pathway in the isolated P. putida strain. An initial hydrolysis formed 3-ketopropanoate, which was then partly decarboxylated to acetaldehyde. The latter was dehydrogenated to acetate, ... doi:10.1046/j.1432-1033.2003.03460.x Materials and methods Chemicals All chemicals were purchased from Sigma-Aldrich Chemi- cal Co. in the highest available purity and used without...

Ngày tải lên: 08/03/2014, 08:20

6 360 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) ... method. In the first step we used the following oligonucleotides: forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTC...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

... GCTGTTATACCAGTATATGG EMSA, oligonucleotides for site 3 P3R CCATAT ACTGGTATAACAGC P4F TGGTGTACTAATTTGATCTATG EMSA, oligonucleotides for site 4 P4R CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA EMSA, oligonucleotides used ... footprinting P8 TGTTATACCAGTATATGGTGTACTA EMSA 94RTf CTCGGCCTCAACTACAGTCGT Reverse transcription 94RTr ACAGGTAGCTGAGCAGCAGAC Reverse transcription 1994i...

Ngày tải lên: 23/03/2014, 04:21

12 462 0
Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

... for pharmacological chaperones. Pyrimethamine, an antimalarial drug with well documented pharmacokinetics, was confirmed as a b-hexosaminidase pharmacological chaperone and compared favorably ... Myers M, Amato A, Kagen-Hallet K, Razvillas B et al. (2001) Phase I and pharmacokinetic study of LU79553, a DNA intercalat- ing bisnaphthalimide, in patients with solid malignan- cies. J Clin...

Ngày tải lên: 30/03/2014, 03:20

11 348 0
w