Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... data and the output meshes. The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressible turbulent atmospheric flows and air quality ... generation, i.e. algebraic and elliptic mesh generation methods, and developed a software package for 3D structured mesh generation for computational d...

Ngày tải lên: 14/03/2014, 13:20

... scenarios. 3. Developing climate change scenarios for small areas of Vietnam Based on software MAGICC / SCENGEN, we have built climate change scenarios for small areas of Vietnam such as ... that rainfall in dry season can decrease whereas rainfall in rainy season can increase and annual rainfall can increase in all research areas under the emission scenarios from highest (A...

Ngày tải lên: 05/03/2014, 16:20

... system we can now obtain weak optical signals, for example, Raman Spectra of Vietnam petrol extracts excited by not only an 2W Argon laser but also by a 30mW He-Ne laser. Key words: Raman spectroscopy, ... spectroscopy, Optical- Second Harmonic Spectroscopy, Surface SH generation. 1. Introduction Laser Raman spectroscopy including Raman Scattering, Resonance Raman Scattering, St...

Ngày tải lên: 05/03/2014, 14:20

... clause and the word/tag pairs for each element of the clause. POS tags provide valuable in- formation about syntactic category as well as certain kinds of shallow semantic information (such as verb tense). ... are non-absolute, making them inappropriate for a rule-based model. Our models handle the defeasibility of these correlations probabilistically, as is standard for machine...

Ngày tải lên: 08/03/2014, 02:21

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from murine tissues....

Ngày tải lên: 18/02/2014, 17:20

... in Ha Long Bay and Hai Phong estuarine area. For all of these regions, the simulated fields of water circulation and water level show mostly well for as very complicated coastal and estuarine ... coast than that is in the central and north - east region. The deposition of the SPM at the bottom is more in the area near Ha Long, Bai Chay and Cat Ba coasts than it is in the central...

Ngày tải lên: 13/02/2014, 12:20

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CAC...

Ngày tải lên: 18/02/2014, 13:20

... tracking after intratracheal (i.t.) administration of an airborne allergen relevant for human allergic disease. The fate of Der p 2 was followed both at the whole-body level by autoradio- graphy ... instillation of [ 75 Se]Der p 2 instead of the last aerosol challenge at day 30. Analysis of BAL fluid from mice instilled with nonlabelled Der p 2 at day 30 displayed an airway inflamma...

Ngày tải lên: 07/03/2014, 21:20

... Proceedings of the 43rd Annual Meeting of the ACL, pages 605–613, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms ... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair d...

Ngày tải lên: 08/03/2014, 04:22

... for syntactical parsers for practical usages, such as information extrac- tion. For example, Yakushiji et al. (2001) extracted argument structures from biomedical papers using a parser based on ... data for the developers to clarify the defects of the grammar statistically. We applied willex to a large-scale HPSG-style grammar as an example. 1 Introduction There is an increasing...

Ngày tải lên: 08/03/2014, 04:22