Family - a novel by Tom Lyons pdf

Tài liệu The message of a master - By John McDonald pdf

Tài liệu The message of a master - By John McDonald pdf

... him again. But here he was back again, and surely some great change had taken place in him. Remarking that a miracle must have happened, he assured me that I had guessed about right, adding, ... through a room delicately perfumed ay an abundance of flowers artistically arranged, to a room which appeared to be his study and where chairs had already been placed for us. His entry...

Ngày tải lên: 15/12/2013, 06:15

50 862 0
Tài liệu Project Management and Scrum – A Side by Side Comparison pdf

Tài liệu Project Management and Scrum – A Side by Side Comparison pdf

... than as a manager controlling the team. The Scrum Master notes and removes obstacles, safeguards the Scrum process, facilitates collaboration, and acts as a “sheepdog” for the team. Whereas ... Comparison – Traditional and Scrum The following table provides a side -by- side comparison of Project Management practices and deliverables with respect to the traditional waterfall approa...

Ngày tải lên: 18/02/2014, 07:20

7 737 0
Tài liệu THE ENTITLED A novel by Frank Deford doc

Tài liệu THE ENTITLED A novel by Frank Deford doc

... ques- tions, Jay. Their presence was so constant that Alcazar soon simply accepted it as a necessary part of the life, like buses and airplanes and autographs and per diem. Alcazar looked at it this way: ... fish, completely. Had standing there in the hall like some dummy waiting for a bus given Alcazar the chance to rape her? Had Jay actually done that? Rape? Jay Alcazar––tall, dark and...

Ngày tải lên: 21/02/2014, 06:20

294 295 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–463 R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaI rFnBPB 163–308 F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–308 R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... GAATTATCTTTAGCTCTAGCTATTGATCC rFnBPB 163–480 NF F GGATCAATAGCTAGAGCTAAAGATAATTC FnBPB (–142–480) F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRI FnBPB (–142–480) R AATGGATCCTTACTTTAGTTTATCTTTGCCG Bam...

Ngày tải lên: 06/03/2014, 00:20

13 515 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

... derivative of tRNA Gly 1 -1 has a single TATA ele- ment at )130 bp and is transcribed to the same levels as the parent. pmutRKX3 has the single TATATAA element of pRKX3 mutated to GATATCA. tRNA Gly 1 -6 ,7 ... phosphocellulose fractions, PC-B and PC-C as well as with the heparin–Sepharose fractions. The reactions were maximally active at 6 lg of both PC-B and PC-C (Fig. 2B; lane 4) an...

Ngày tải lên: 20/02/2014, 02:21

15 484 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... sequence Wild-type MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge- charge interactions. Proc Natl Acad Sci USA 106,...

Ngày tải lên: 15/02/2014, 01:20

8 740 0
Tài liệu Alice Cogswell Bemis A Sketch by a Friend pdf

Tài liệu Alice Cogswell Bemis A Sketch by a Friend pdf

... wish that I had a home nearer my family. "What did 'Sister' say? What did Alan say and do? My best love and congratulations to each. I am so glad to have another granddaughter." Each ... pitched for a temporary abiding place. As soon as possible he took passage for Boston, where he made a contract with the captain of a small bark to sail for Pemaquid and transpor...

Ngày tải lên: 18/02/2014, 09:20

21 326 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... factor. Thus, TransLISA can replace EMSAs and may be used in various applica- tions and research fields where quantitative, cost-effective and large-scale measur...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... Science, Hokkaido University, 3-1 -1 Minato, Hakodate, Hokkaido 04 1-8 611, Japan Tel ⁄ Fax: +81 138 40 5550 E-mail: takagi@fish.hokudai.ac.jp Database Nucleotide sequence data are available in the ... C), heparitinase II (10 munits, H), hyaluronidase SD (25 munits, Y) and endo -a- N-acethylagalactosaminidase (70 munits, E). The HMW aggregate was digested only by heparitinase II (arrowh...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
w