PEOPLE AND WORK IN EVENTS AND CONVENTIONS: A Research Perspective

PEOPLE AND WORK IN EVENTS AND CONVENTIONS: A Research Perspective

PEOPLE AND WORK IN EVENTS AND CONVENTIONS: A Research Perspective

... South Africa. She has published in the area of tourism planning and management, appearing in Anatolia and Journal of Human Resources in Hospitality and Tourism. She is also a board member of ATLAS-Africa. ... range of subjects in leading international tourism and hospitality journals and presented her research at international and national conferences. Her two maj...
Ngày tải lên : 11/03/2014, 18:05
  • 247
  • 441
  • 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... in nature to a data manager which fails to free data, but is easier to detect and prevent. • Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... more data than requested. The Mach kernel can only handle integral multiples of the system page size in any one call and partial pages are discarded. Since the data manager may h...
Ngày tải lên : 12/09/2012, 15:05
  • 23
  • 1.3K
  • 1
A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse

A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse

... how human beings interact in an economy is beginning to be questioned, and instead concepts associated with evolutionary biology are starting to be promoted among certain leading academics. Perhaps ... heavily in improving their English language skills on top of their main academic and research duties; in practice this means that specialist translation services as well as ESP teac...
Ngày tải lên : 07/09/2013, 12:58
  • 33
  • 1.1K
  • 3
An investigation into syntactic and semantic features of idioms denoting work in english and vietnamese

An investigation into syntactic and semantic features of idioms denoting work in english and vietnamese

... contrastive analysis and to classify them in accordance with their semantic and syntactic feature. 3) Finding and making a comparison and contrast between structural mechanisms then semantic ... and Vietnamese- have been collected and treated differently at various times. We have collected and analyzed data in order to find out the differences and similarities in...
Ngày tải lên : 26/11/2013, 13:16
  • 13
  • 1.9K
  • 4
A study on syntactic and pragmatic features of asking and answering in english and vietnamese job interviews

A study on syntactic and pragmatic features of asking and answering in english and vietnamese job interviews

... a grammatical unit that is an arbitrary union of a sound and a meaning and that cannot be further analysed”. From this definition, we can state that elements that have a semantic or grammatical ... and classifying EWGH and VWGT as single words and WG, analyzing the data to find out the syntactic and semantic features of EWGH and VWGT, comparing and contrasting to...
Ngày tải lên : 26/11/2013, 13:16
  • 13
  • 901
  • 0
A study of modality expressed in terms of grammaticalization and lexicalization in english and vietnamese

A study of modality expressed in terms of grammaticalization and lexicalization in english and vietnamese

... grammaticalization and lexicalization denoting modality in English and Vietnamese? 2. What are the similarities and differences between English and Vietnamese in terms of grammaticalization and lexicalization ... ways of analizing modality, as follows: a. Lexicalization Grammaticalization + Lexical meanings of modal verbs Distinction of grammatical + Modal adjectives ca...
A cross cultural study of giving compliments and responses in english and vietnamese

A cross cultural study of giving compliments and responses in english and vietnamese

... “Communication is, rather, the successful interpretation by an addressee of a speaker’s intent in performing a linguistics act” (Georgia M. Green, Natural Language Understanding, p.1). And “” ... gratitude goes to Mr. Tinh (M .A) who teaches at ASEM Vietnam center for his essential materials and advice. Last but not least, I give a very special thanks to my famil...
A study into words, idioms denoting 'richness' and 'poorness' in enghish and their vietnamese equivalents

A study into words, idioms denoting 'richness' and 'poorness' in enghish and their vietnamese equivalents

... the same categorical meaning. They do not share all the grammatical features. Thus, all the lexemes sharing categorical meaning do not have all the grammatical meanings. 1.3.2. Lexical meaning ... consists and partly by it grammatical meaning. According to Nguyen Thi Van Lam (2002:16), “all lexemes with full word-forms have a grammatical, more particularly a categorical, meaning.”...
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT ... cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatg agcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgatt...
Ngày tải lên : 12/02/2014, 10:20
  • 9
  • 497
  • 0

Xem thêm