Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
... Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study Eva-Maria Erb1, Johan Stenflo1 and Torbjo¨ ... shown).Kinetics of membrane bindingThe kinetics of binding to PL membranes of the zymogen factor X, activated factor X (factor Xa) and the active siteinhibited form DEGR -factor Xa as well as the the factor ... Ca2+concentration at which half-maximum binding occurs.Kinetics of membrane bindingMembrane binding experiments on factor X, factor Xa,DEGR -factor Xa and the Gla-containing fragments of factor...
- 6
- 401
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... lactoferrin with a lanthanide ion (Sm3+)at3. 4A ˚resolution. Acta Crystallogr. D55,1799–1804.36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti-tative image analysis and ... Franke, W.G., Bergmann, R. &Johannsen, B. (1997) Uptake of 169Yb complexes in normal and tumour cells: influence of ligand and metabolic cell activity and stability of cellular association. ... Complexation of ytterbium to human transferrin and its uptakeby K562 cellsXiu-lian Du1, Tian-lan Zhang1, Lan Yuan1, Yong-yuan Zhao1, Rong-chang Li1, Kui Wang1, Siu Cheong Yan2,Li...
- 9
- 385
- 0
Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modified protein and yields fragments with low immunoreactivity pptx
... gel-permeation and SDS/PAGE under nonreducing conditions. Bovine pancreatictrypsin (N -a- tosyl-L-phenylalanylchloromethane treated,type XIII) and chymotrypsin (N -a- tosyl -L-lysylchloro-methane t reated, ... in Table 1, thatapparently are b etter explained b y assuming an inhibitoryeffect of the peptides produced by hydrolysis of BLG at hightemperature.Table 1 . Thermal stability of trypsin and ... B.W. (1993) Enzymatic hydro-lysis of whey proteins. Influence of heat treatment of alpha-lac-talbumin and beta-lactoglobulin on their proteolysis by pepsin and papain. Neth. Milk Dairy J. 47, 15–22.18....
- 11
- 526
- 0
Tài liệu Báo cáo Y học: Interaction of decorin with CNBr peptides from collagens I and II Evidence for multiple binding sites and essential lysyl residues in collagen pot
... chondroitin/dermatan sulfate PGs at the d and ebands in the gap zone of the fibrils formed by the quarterstaggered array of type I collagen molecules, and thepresence of keratan sulfate PGs at the a and ... Shirk, R .A. , Parthasarathy, N., San Antonio, J.D., Church, F.C.& Wagner, W.D. (2000) Altered dermatan sulfate structure and reduced heparin cofactor II-stimulating activity of biglycan and decorin ... from bovine skin and its CNBr peptideswere already available and characterized by our laboratory[27–30].Sulfosuccinimidyl acetate, p-nitrophenyl phosphate,avidin conju gated with alkaline...
- 10
- 575
- 0
Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina pot
... combinations:(1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGGATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAGATTCAATTATTTAGTACAAATGGCTAAGAGGCATTT);(2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAACAACAGACGATGAGGCAACTTA);(3) ... interact with ABP130, ABP96, and ABP64 in the two-hybrid assay. Wefound a strong interaction between AFP and ABP130 and ABP96, but no interaction with ABP64 (Table 1).956 I. A. Hansen et al.(Eur. ... AB ¼ anti-AFP. Visualization of the bands was with a secondary anti-rabbit antibody coupled with alkaline phosphatase followed by NBT/BCIP colour reaction.Table 1. I nteraction of AFP with different...
- 7
- 408
- 0
Báo cáo Y học: Interaction of plasminogen activator inhibitor type-1 (PAI-1) with vitronectin Characterization of different PAI-1 mutants pdf
... heparin; mutational analysis; surface plasmon resonance. The urokinase-type plasminogen activation system playsan important role in tumor growth, invasion, and metastasis. The serine protease ... shortrecurrence-free and overall survival of tumor p atientsaf¯icted with a broad variety of cancers, e.g. mammary,ovarian, cervical, colorectal, bladder, renal and lungcarcinomas [2,3]. In line with this, ... measured at 450 nm. Surface plasmon resonance analysis of (mutant) PAI-1 binding to Vn Surface plasmon resonance (SPR) studies were conducted with a BIACORE 2000 (Biacore AB, Uppsala, Sweden).Approximately...
- 9
- 295
- 0
Báo cáo Y học: Interaction between p21-activated protein kinase and Rac during differentiation of HL-60 human promyelocytic leukemia cell induced by all-trans-retinoic acid pdf
... granulocytes in spite of the fact that they wereobserved abundantly in cytoplasm. Whereas reactiveoxygen species are classically thought of as cytotoxic and mutagenic or as inducers of oxidative ... differentiation, the interactions between Rac and PAKproteins located upstream of the signal pathways wereexamined.The present study revealed that Rac and PAK isoformsincreased in both cytosol and ... week,andRacandPAKwereassayedinbothcytosolandmembrane fractions. Rac occurs as two isoforms (Rac1 and Rac2) that are 92% identical in amino-acid sequence and Rac2 is more abundantly expressed in...
- 8
- 419
- 0
Báo cáo Y học: Interaction of the GTS1 gene product with glyceraldehyde3-phosphate dehydrogenase 1 required for the maintenance of the metabolic oscillations of the yeast Saccharomyces cerevisiae pdf
... (5¢-3¢)15¢-CCCGAAGCATGCTGTGCCTAC-3¢25¢-CCCGAAGCATGCTGTGCTCAC-3¢35¢-GGAGAATTCGTTGGGCTGAGCTTCTGATCC-3¢45¢-TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢55¢-CTTTGAATTCTGCTGTAACCCGTACATGCC-3¢65¢-ATTAGAATTCGCGGCTAAAGTTAAGCATGC-3¢75¢-GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢85¢-TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢95¢-GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢10 5¢-TAATAGGAATTCTGATCATTTTGTTTTGTG-3¢11 5¢-AACAAGAATTCATGGTTAGAGTTGC-3¢12 5¢-AGGAGCTCGAGTTAAGCCTTGGCAAC-3¢13 ... (5¢-3¢)15¢-CCCGAAGCATGCTGTGCCTAC-3¢25¢-CCCGAAGCATGCTGTGCTCAC-3¢35¢-GGAGAATTCGTTGGGCTGAGCTTCTGATCC-3¢45¢-TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢55¢-CTTTGAATTCTGCTGTAACCCGTACATGCC-3¢65¢-ATTAGAATTCGCGGCTAAAGTTAAGCATGC-3¢75¢-GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢85¢-TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢95¢-GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢10 ... 5¢-AGGAGCTCGAGTTAAGCCTTGGCAAC-3¢13 5¢-AACTAACTAGTACTTGTATGCTAAAGG-3¢14 5¢-TTGTGTGTGTTGGTGAAATATCAAACCAAGTTCTTGATGAATTTC-3¢15 5¢-GTGTATTTTTCTTCGTTAACACCCATGACGAACATTGGGGCGGTG-3¢Fig. 1. Determination of...
- 10
- 410
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... Laxmaiah Manchikanti1, Vijay Singh2, Frank J.E. Falco3, Kimberly A. Cash4, Vidyasagar Pampati5 1. Medical Director of the Pain Management Center of Paducah, Paducah, KY and Associate ... 539-45. 15. Schwarzer AC, Wang SC, Bogduk N, et al. Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain. Ann Rheum ... Department of PM&R, Temple University Medical School, Philadelphia, PA, USA 4. Research Coordinator at the Pain Management Center of Paducah, Paducah, KY, USA 5. Statistician at the Pain Management...
- 12
- 669
- 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... autoradiograms of the ribonuclease protection analysis of c-myc mRNA are shown in panel A. Autoradiographic exposurewas for 2 days on Kodak X- Omat film with an intensifying screen.Row a, transcription ... therapy as an attractive approach foranticancer treatment. In this context, activation of themitogen-activated protein kinase (MAPK)/extracellularsignal-regulated kinase (ERK) signaling pathway ... Regulation of Ras. GTP loading and Ras–Raf association in neonatal rat ventricular myocytes by Gprotein-coupled receptor agonists and phorbol ester. Activation of the extracellular signal-regulated...
- 10
- 703
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ