Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
... Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study Eva-Maria Erb 1 , Johan Stenflo 1 and Torbjo¨ ... shown). Kinetics of membrane binding The kinetics of binding to PL membranes of the zymogen factor X, activated factor X (factor Xa) and the a...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... lactoferrin with a lanthanide ion (Sm 3+ )at3. 4A ˚ resolution. Acta Crystallogr. D55, 1799–1804. 36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti- tative image analysis and ... Franke, W.G., Bergmann, R. & Johannsen, B. (1997) Uptake of 169 Yb complexes in normal and tumour cells: influence of ligand and metabolic cell activity and stability of cel...
Ngày tải lên: 08/03/2014, 09:20
Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modified protein and yields fragments with low immunoreactivity pptx
... gel-permeation and SDS/ PAGE under nonreducing conditions. Bovine pancreatic trypsin (N -a- tosyl- L -phenylalanylchloromethane treated, type XIII) and chymotrypsin (N -a- tosyl - L -lysylchloro- methane t reated, ... in Table 1, that apparently are b etter explained b y assuming an inhibitory effect of the peptides produced by hydrolysis of BLG at high temperature. Table 1 . Ther...
Ngày tải lên: 21/02/2014, 15:20
Tài liệu Báo cáo Y học: Interaction of decorin with CNBr peptides from collagens I and II Evidence for multiple binding sites and essential lysyl residues in collagen pot
... chondroitin/dermatan sulfate PGs at the d and e bands in the gap zone of the fibrils formed by the quarter staggered array of type I collagen molecules, and the presence of keratan sulfate PGs at the a and ... Shirk, R .A. , Parthasarathy, N., San Antonio, J.D., Church, F.C. & Wagner, W.D. (2000) Altered dermatan sulfate structure and reduced heparin cofactor II-stimulating...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina pot
... combinations: (1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGG ATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAG ATTCAATTATTTAGTACAAATGGCTAAGAGG CATTT); (2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC AACAGACGATGAGGCAACTTA); (3) ... interact with ABP130, ABP96, and ABP64 in the two-hybrid assay. We found a strong interaction between AFP and ABP130 and ABP96, but no interaction with ABP64 (Table 1)....
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: Interaction of plasminogen activator inhibitor type-1 (PAI-1) with vitronectin Characterization of different PAI-1 mutants pdf
... heparin; mutational analysis; surface plasmon resonance. The urokinase-type plasminogen activation system plays an important role in tumor growth, invasion, and metastasis. The serine protease ... short recurrence-free and overall survival of tumor p atients af¯icted with a broad variety of cancers, e.g. mammary, ovarian, cervical, colorectal, bladder, renal and lung carci...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo Y học: Interaction between p21-activated protein kinase and Rac during differentiation of HL-60 human promyelocytic leukemia cell induced by all-trans-retinoic acid pdf
... granulocytes in spite of the fact that they were observed abundantly in cytoplasm. Whereas reactive oxygen species are classically thought of as cytotoxic and mutagenic or as inducers of oxidative ... differentiation, the interactions between Rac and PAK proteins located upstream of the signal pathways were examined. The present study revealed that Rac and PAK isoforms increas...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo Y học: Interaction of the GTS1 gene product with glyceraldehyde3-phosphate dehydrogenase 1 required for the maintenance of the metabolic oscillations of the yeast Saccharomyces cerevisiae pdf
... (5¢-3¢) 15¢-CCCGAAGCATGCTGTGCCTAC-3¢ 25¢-CCCGAAGCATGCTGTGCTCAC-3¢ 35¢-GGAGAATTCGTTGGGCTGAGCTTCTGATCC-3¢ 45¢-TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢ 55¢-CTTTGAATTCTGCTGTAACCCGTACATGCC-3¢ 65¢-ATTAGAATTCGCGGCTAAAGTTAAGCATGC-3¢ 75¢-GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢ 85¢-TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢ 95¢-GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢ 10 5¢-TAATAGGAATTCTGATCATTTTGTTTTGTG-3¢ 11 5¢-AACAAGAATTCATGGTT...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... Laxmaiah Manchikanti 1 , Vijay Singh 2 , Frank J.E. Falco 3 , Kimberly A. Cash 4 , Vidyasagar Pampati 5 1. Medical Director of the Pain Management Center of Paducah, Paducah, KY and Associate ... 539-45. 15. Schwarzer AC, Wang SC, Bogduk N, et al. Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low...
Ngày tải lên: 26/10/2012, 09:07
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... autoradiograms of the ribonuclease protection analysis of c-myc mRNA are shown in panel A. Autoradiographic exposure was for 2 days on Kodak X- Omat film with an intensifying screen. Row a, transcription ... therapy as an attractive approach for anticancer treatment. In this context, activation of the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK...
Ngày tải lên: 21/02/2014, 01:21