Báo cáo Y học: Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide pptx

Báo cáo Y học: Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide pptx

Báo cáo Y học: Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide pptx

... Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide Kaori Sawada 1,2 , Kazuyoshi Ukena 1,2 , ... Iijima, N., Matsumoto, Y. , Hosoya, M., Fujii, R., Watanabe, T., Kikuchi, K., Terao, Y. , Yano, T., Yamamoto, T., Kawamata, Y. , Habata, Y. , Asada, M., Kitad...

Ngày tải lên: 08/03/2014, 16:20

9 383 0
Tài liệu Báo cáo Y học: Novel bradykinins and their precursor cDNAs from European yellow-bellied toad (Bombina variegata) skin potx

Tài liệu Báo cáo Y học: Novel bradykinins and their precursor cDNAs from European yellow-bellied toad (Bombina variegata) skin potx

... (Thr6)-bradykinyl-IAPEIV in R. rugosa and (Val1, Thr6)-bradykinin and (Val1,Thr6)-bradykinyl-VAPAS in R. nigromaculata [13,14]. Additional structural variants such as phyllokinin (bradykinyl-IYsulfated) ... standardization of each synthetic peptide was achieved by acid hydrolysis of a known gravimetric quantity of lyophilisate followed by amino acid analysis using an Applied Bio...

Ngày tải lên: 21/02/2014, 15:20

8 555 0
Tài liệu Báo cáo Y học: Novel complexes of mammalian translation elongation factor eEF1AÆGDP with uncharged tRNA and aminoacyl-tRNA synthetase potx

Tài liệu Báo cáo Y học: Novel complexes of mammalian translation elongation factor eEF1AÆGDP with uncharged tRNA and aminoacyl-tRNA synthetase potx

... tRNA channeling; eukaryotic protein synthesis; BIAcore analysis. Aminoacyl-tRNA synthetase (ARS) and eEF 1A are the proteins that advance the translation elongation cycle. ARS binds ATP, an amino ... elskaya@biosensor.kiev.ua Abbreviations: ARS, aminoacyl-tRNA synthetase; eEF 1A, eukaryotic translation elongation factor 1A (formerly EF- 1a) ; EF 1A, prokaryotic translation elongation...

Ngày tải lên: 21/02/2014, 15:20

8 504 0
Báo cáo Y học: Novel protein phosphatases in yeast docx

Báo cáo Y học: Novel protein phosphatases in yeast docx

... supports the proposal that Hal3 acts as a negative regulatory subunit of Ppz1 and inhibits the activity of the phosphatase by binding to its C-terminal catalytic moiety [12]. A remarkable feature of ... outlined above, it is clear that these novel phosphatases play relevant roles in the biology of the yeast (cell integrity, cell c ycle regulation, cation homeostasis,...

Ngày tải lên: 17/03/2014, 23:20

6 442 0
Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx

Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx

... and cytoplasmic. The cytoplasmic region of the mIg heavy chain is quite short and incapable o f signal transduction; instead, Ig -a/ mb1 and the B29/Ig-b heterodimer play the main roles at the beginning ... close to the N -terminal r egion of the cytoplasmic domain. K inases in the Src family, such as Lyn phosphorylate tyrosine residues in ITAM and phosphorylated I...

Ngày tải lên: 24/03/2014, 03:21

10 332 0
Báo cáo y học: "In-flight medical emergencies: time for a registry"

Báo cáo y học: "In-flight medical emergencies: time for a registry"

... passenger until the airplane lands and the passenger can be taken to an emergency room [2]. Ideally, physicians can learn about the physiological changes that occur during flight and tailor their care ... medical kit. ASMA periodically updates these recommendations, but the latest recommendation specifically cites the lack of industry-wide data as a problem and encourages...

Ngày tải lên: 25/10/2012, 10:06

2 361 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department of Dental Sciences and Surgery, University of Milano, Milano, Italy 6. Department of Medical Genetic, ... after a routine hema- tological investigation and after the assessment of radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Sca n (Fig. 6) of the...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

... receptor-mediated signalling antagonist Mani D. Kalluri 1, *, Praneel Datla 2, *, Akshaya Bellary 1, *, Khalander Basha 1 , Ashwani Sharma 1 , Anuradha Sharma 1 , Shiva Singh 1 , Shakti Upadhyay 2 and ... TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense) 5¢- GGTAGATCATCTCTGCC TGAGTATC - 3¢ (antisense), IL-8 5¢- GCCAAGGAGTGCTAAAGAACTTAG -3¢ (sense) M. D. Ka...

Ngày tải lên: 22/03/2014, 21:20

14 202 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... however, abundantly glycosylated and the apparent molecular mass on SDS/PAGE has been estimated to 120±140 kDa [11,12]. Human BSSL has a unique primary structure as compared to other mammalian lipases. ... for secretion of rat pancreatic BSSL [15]. On the other hand, we and others have shown that t he repeats are completely dispensable for the typical functional properties of...

Ngày tải lên: 24/03/2014, 03:21

9 521 0
Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

... Tohru Nakanishi 1 , Takashi Nishida 1,3 , Takako Hattori 1 , Teruko Takano-Yamamoto 2 and Masaharu Takigawa 1,3 1 Department of Biochemistry and Molecular Dentistry, and 2 Department of Orthodontics, ... with 1mg : mL 21 actinase E (Kaken Pharmaceuticals, Tokyo, Japan), and the radioactivity of the material precipitated with cetylpyridium chloride was measured in a scintil...

Ngày tải lên: 24/03/2014, 04:21

8 377 0
Từ khóa:
w